Transmis în data de 11 Martie 2012 din Moldova
0 privesc
Finala concursului Eurovision 2012. Selecţia Naţională. Retransmisiune de pe Moldova1
Din păcate nu dispuneți de un player adecvat pentru vizionarea live-ului. Vă invităm să descărcați cea mai recentă versiune Adobe Flash Player
Comentarii
  • Radu Bine aţi venit!
  • Radu Cine credeţi că va câştiga?
  • Elena Multumesc!
  • guest_114 la mine se aude sunet si de la replica !
  • alex Bine v-am găsit!
  • guest_98 Lasati va rog frumos Eurovisionul, nu intrerupe-ti.
  • Elena Piesa lui Adrian Ursu imi place dar nu-mi place cum el o canta
  • Josan Cornel cred că Andrian Ursu
  • Stas Nu intrerupeti va rog Eurovisionul !
  • Puff :) bine v-am gasit...
  • guest_41 Akord
  • Maia Paralela 47
  • guest_184 ursu o platit mai mult :) el si va castiga
  • Josan Cornel Ţin pumnii pentru Dara
  • alex Va câștiga Parfeni sau Croitoru.
  • Bazil eu
  • guest_114 ursu o investit mult in reclama , credka nu degeaba , o sa mearga el , ori akord
  • guest_41 Croitoru
  • Daniel Moraru Va rugam foarte mult votati pentru transbalkanika!!!
  • Radu alex, pentru cuvinte urâte te banez :D (glumesc)
  • esmy frumos inceput!place
  • guest_41 haideti sa o sustinem pe Cristina Croitoru
  • Puff care o cînta mai bine live - ăla să meargă la Baku... să nu fie ruşine după
  • Ion cine sunt fetele de linga Marcel?
  • guest_184 o zis ca priviti live pe www.md :))))))) si oaie :D
  • guest_126 anul trecut prezentatorii erau mai buni
  • Radu Ion, Evelina Vârlan şi Dorina Gherganov
  • Ion Radu - merci mult
  • guest_126 oameni buni, de ce camera se hatsana???
  • Ana numai de la orange putem vota?
  • Radu Ana, da. Fiindcă ei sunt sponsorii
  • alexndrugurdila Eurovizion Moldova? Căcatul căcatului. Le-o pus pe urâtele celea două, plus Marcel care (mult respect), dar nu are carizmă deloc. Muzica de la început? FAIL. Tipii erau îmbrăcați în cămeși, deși era obligator să fie în costume naționale! MOLDOVA, STAY HOME!
  • kuku da la voi cine e sponsor?
  • Мулю да ундей Павлуша Турку?
  • Cristinutza eu as vrea ca Dora sau Cristina Croitoru sa reprezinte MD
  • kuku asta cineva care are hate pe gurdila))
  • )))) alexandru gurdila a scris pi pe facebook la fel haaa
  • Spectator Da...frumos)))) bun concurent :D
  • esmy Pavlusha sade acasa, coace o piesa pentru anul viitor probabil )))
  • )))) alexandru gurdila a scris si pe facebook la fel haaa
  • Мулю ши ку сатанеле иштя??? май гини сэ дукэ Зинаида Жуля
  • Crawford Dafuq is this? :))
  • Spectator blanche da toti is negru ca niste satanisti, doamne iartama...
  • grigore danunah :D
  • Radu Pavel Turcu s-a reîncărnat? :)
  • Azur Doamne fereste!!!
  • Cristinutza :d:d:d
  • Mariana mndaa.. inceputul e oribil
  • igor pasha o sa castige
  • zayka cine le-a permis doamne?
  • Cristinutza vom deja cine e mai bun la sfirsit
  • Spectator pasha pasha....principalu tarasiuk sa nu ajunga departe.
  • Vero ei inca is melancolici dupa Lordi
  • kuku aeștia vor la eurovizion?
  • kuku sau doar cîntă să nu fie necîntaț?
  • igor da
  • AxEL Ținem pumnii pentru Alecu Mătrăgună și paralela 47!!!!!!!!!!!!!!!!!!
  • Мулю щи кончиные ЭМО... фугэрицый нах майрепеде
  • Cristinutza dc sa nu ajunga Tarasiuc ?
  • Spectator show mare, cantec aiurea... adik cv original
  • Spectator fuuuuuuuuuuuuuuuuuuuuuuuu
  • maria vorba ceea o bojee:)
  • guest_10 ăştea vor să trimită salutări din iad... mai rău că ar putea fi crezuţi... :)
  • Cristinutza acush ii vedem :D:D:D
  • iulia Oh Doamne.. ce a fos asta? twilight moldovenesc?
  • Vero fuuuuuuuuuuuuuuuuuuu, hlizita asta
  • Cristinutza adika vom vedea si evolutia lor
  • Ion oooooooooo drugu meu - Prince
  • maria vorba ceea o bojee
  • erertre what the fuck is wrong with u Moldova?
  • kuku da guță de ce nu e cu onoje la proteste)))
  • anonymous da nigga aista cu oaia asta vreu sa se viibeasca cu un fel de retro-shit copiat de la muzica facuta de americani cu 5 ani in urma)))))0
  • zayka iiiiii da aista cio perdut pe aici?
  • Ion anii `70 ... dar imi place
  • Spectator park ii c*rva
  • )))) mie imi place
  • Vitalie Numa' nu astia...
  • white se cam screme fata
  • zayka guta e numai de forma:)
  • Ion ii zavadnaia
  • GP mda
  • eu fatsa de primu,mai merge =)))
  • Elena Voi vedeti pe cineva plecind la bacu sa faca fata acestui eveniment eurovizion ??
  • Spectator Stati sa vedeti pe al 3 lea :D
  • anonymous this is shit, not music (((
  • jjjj mmmmm nu cred ca e pentru EV.pisa
  • guest_155 elena , da peste vreo 15 ani))))
  • Tatiana ha ha
  • Vero sa plece vedem, dar fara a face fatza lol
  • nonym Pe cine preferati?
  • Ion Elena - mie imi place cintecul Cristinei Croitoru ...
  • kkkk fu blin,nii rushine!
  • Мулю щи кончита... Трусюка асты ый бунэ сэ кынте нумай ын парилкЭ
  • Olga curcubeu blin
  • lynka of numai nu curcubeii astia
  • alexandrugurdila o iaca mujiku!
  • Elena si tot asa sa vedem pina la final cei 21 participanti
  • zayka oo ceva mai natural:D
  • lynka of numai nu curcubeii astia sa plece
  • Elena ooo pasa parfeni acum
  • Suruceanu o, Pasha e unul din cei care merita sa mearga la Baku
  • Vero Paska saracul, de cind se kinuie
  • Spectator Pasha Pasha Pasha!!!
  • kuku gurdilî,,asta tu ești?
  • guest_200 îl vrem pe Pavel Turcu
  • Elena Imi place coregrafia lui la piesa
  • Ion bravo Brashoveanu - patzanash talentat
  • Victor ei macar show face deam e bine
  • lynka ii klar,nu merge nici asta
  • guest_132 manciu
  • adelush in sfirsit niste voci bune
  • Мулю Брэгович + Рики мартин ку ун глас де педик
  • eurovision natalia barbu unde esti
  • lololololo victr solgasen
  • eu ceva mai melodios =))))
  • zayka da fetele estea asa is de speriete
  • lynka ii klar numai merg ei chiar cu asta
  • vika stil copiat de la Bregovici
  • kuku de parfenii))
  • Corina Cristina Croitoru a cantat deja?
  • Crawford nu place. ridicol nu ştiu cum
  • Vitalie Zdob si Zdub, unde sunteti?
  • iulia hai k ii bun
  • Elena inca nu a cintata cristina croitoru
  • hh shi pasha poate anu ista?))
  • Olga inainte cinta mai bine
  • Azur *uinea!!!
  • oha nu e rau
  • Tatiana nu văd show :(
  • zayka :d
  • igor cine daca nu el ? anu asta n-avem noi asortiment
  • Someone urat !
  • kuku this trumpet makes you my girlfriend?
  • lynka eu cred ca nu o sa fie si anul asta cu chestia ca blin nici nu aveai ce alege sau asculta
  • lololololo normal , dar nui pentru evrovidineye
  • guest_126 e aiurea
  • zayka olga el are emotii
  • xxx se merita investitiile???
  • Spectator cantec stricat de show...
  • Puff ...tras de urechi...
  • ew blin ce de prost cinta si tot show lui
  • clau foarte urâtă faza a fost.mda ( aproape îmi plăcea
  • oha daca
  • ew da niciodata ceva tolkova nu a facut :D ))))
  • oha daca are emotii aici la baku ce face?
  • Мулю Парфени - Педик ку гэине... ха-ха!
  • Elena zdupi nus nelic ciobanu nui concurenta nu as vedea intre ei atunci cine ??
  • Olga se vede ca se screme oleaca
  • Vero dansatorii is din kiev
  • Victor eram de ;la inceput de o parere mai buna dar la final cam nu pre
  • ew pina cind ceva bine si frumos au fost MC GOOTSA
  • Victor urmatoru sa vedem
  • oooo pidaruuuu ista fuuuuu
  • Faneuro ooooooooooo manciu hai davai!!!!!1
  • De Media vocea prea tare, muzica incet
  • Spectator Victor +1
  • zayka pisa pantalonii
  • medik "Missing Plug-in"! Ce plug-in trebuie aici ?
  • De Media nu, nu ai sanse
  • Elena ooo
  • anonymous yaay, alexandru manciu the best!! eu il sustin!!
  • Elena manciu
  • Spectator flash player
  • ew si aista care a facut investitii de 200-300 euro in prostimea lui
  • lynka asta la disco merge cu manciu
  • oooo alexandru manciu shit !!!!!!!!
  • Spectator iar aista cu esarfa ...
  • om oooo mush Manciu rupe ... da ce o slabit undei burta :)
  • DeMedia jf
  • nonym toti sunt asa de colorati azi? :D
  • kkkk nafiga fularu shela?
  • oooo nici nu are glas
  • DeMedia Hmmm, baietii de la JF, cool
  • kuku daaaaa
  • kuku manciu e bun
  • kuku manciu e bun
  • Radu MODĂ, ce înţelegeţi voi în ea? :))
  • Corina iar el cu fularu la gat blin :D
  • Victor sii cu golubiatnicu cela din urma ..nu merge
  • adelush kuku e prost
  • FourWays Asa suna piesele de umplutura intr-un concurs. Pacat ca toate piesele din concurs suna a piese de umplutura.
  • Victor piesa e buna
  • anonymous ii frig kredka la gatisor :DD
  • eurovision si e cu clovnul asta
  • Olga iara curcubeu
  • Elena Anul acest putin sau interesat de eurovizion care sa fie acuza ??
  • oha cinta bine live
  • kuku eu nu de 2 ori am scris ca e bun,,,ci de 4
  • Puff ...după trei ani de gri avem tendinţa de culoare pe scenă Ş
  • oooo toti sunt imbracati de parca au venit la matineu la gradinita ehh moldova moldova mai ai mult pina la europa
  • guest_158 fularu se combina cu papushii
  • zayka numai nuu culoarea rosie
  • kuku adelush e banat?
  • DeMedia cintecu nu merge
  • guest_142 imi place cum cinta Manciu...in comparatie cu cei care au cintat pina acuma..
  • Spectator scroafa asta de manciu iar so ingrasat...
  • white privesc.eu, merge greu transmisiunea, Londra nu poate privi normal!
  • jeki203 Prea,prea.......nu e frumos deloc
  • clau nonym_ e primăvara în Moldova :D
  • Spectator oooo si o c*rva rosie :D :D :D
  • kkkk shi kureaua
  • kuku radu,,,ian fă a miracle
  • lynka sa inteleg ca sa pus accent pe vestimentatie macar sa fie colorate))))
  • Vero asta o sa fie mereu accesoriul lui personalizat...inca nu v-ati prins ? :)
  • vaseacardan la muls:D
  • guest_103 spuneti-miva rog frumos cum il chema pe primul care a cintat?
  • Azur am o senzatie ca e un video din arhiva anilor 90
  • M Fularu e asortat cu krazovcele way
  • guest_40 spuneti-mi va rog da mariana mihaila a evaluat deja?
  • Sergiu Salut
  • vaseacardan coool piesa:)
  • kkkk fata sheia danseaza ne vtemu
  • anonymous si ku kureaua
  • Tatiana Până când Manciu e cel mai bun
  • zayka da in costum elegant si in ghete urit
  • Misu Cum pot vedea de pe iPad , doar audio mege
  • Victor fluaru e roshu cred sa nu-l deoache
  • adelush "la muls" cuvinte de aur :D:D
  • DeMedia oo-oo
  • Radu white, ce viteză ai la net? probabil nu îţi ajunge viteză
  • Azur Da cine e din Londra ?
  • kuku mariana e la spital,,,ce nu ai auzit?
  • Ion Mariana Mihaila inca nu a cintat
  • Elena De cine conteaza cel mai mult cin e va cistiga de juriu sau de telespectatori??
  • eu tixii ujas
  • guest_40 please.......a evaluat mariana mihaila?
  • lynka vapse nu se combina scena cu el
  • oha pe trm nu merge aproape deloc pe privesc.eu un pic mai ok
  • iulia nea
  • guest_40 thxxxxx
  • M Victor, moldovenii nu pot fi deocheti, ei asa s-au nascut
  • guest_158 koroha plea
  • zaetsMD scrieti aici sugestile, parerile... https://www.facebook.com/Orange.Moldova
  • kkkk nik normal!
  • hmm am auzit ca mariana a nimerit in spital la protv
  • Spectator nam nevoie
  • guest_10 transmisiunea live pe trm e foarte proasta!!!!!!
  • Мулю ТРМ - адунэтурэ де прошть прэпэдиць... ни сайту нуй лекреаза щиз де конченые
  • zaetsMD @guest_10, scrie aceasta pe pagina oficiala Orange de pe FB
  • lynka da privesc, eu ii bun
  • hhgj vadca nu merge eurovizionu
  • lynka la M1 rau, rusine
  • guest_40 da adrian ursu a evaluat?ca eu doar acum am relizat ca a inceput concertul anului si imi era frica sa nu scap pe "cei mai celebri"cintareti
  • Germania Votati Nicoleta Gavrilita, cintecul e ft bun
  • Ion cintecul acesta e al Cristinei Croitoru - bravo
  • DeMedia Cei de la Trm nici o transmisiune online normala nu pot asigura....
  • igor transbalkanika
  • DeMedia o sa o votez pe Dara : )
  • white Nicoleta Gavrilita are cea mai buna piesa!
  • eu TRM asta cei,televiziune nationala????? =)))) nu merita :D
  • Anastasia priviti aici http://www.eurovision.tv/esctv
  • Natachzka Nu a cintat Ursu
  • hmm credca anul acesta cintecele sunt slabe deoarece pe starurile noastre nu le intereseaza kurorturile de la baku))))
  • Florida da cine a evaluat pina acum?
  • vioara hmmmmmm
  • Germania La toti se incarca greu ori doar la mine?
  • Spectator Si la mn este oleac
  • Florida si la mine se incarca greu
  • muhha off pe aestea de unde io mai luat
  • lynka la mine ok
  • Puff ...la toţi. aşteaptă puţin, după e ok..
  • Elena emoti emoti
  • Me prezentatorii frineaza seriosss
  • guest_155 aista cu ochelari se bilbie parca prima data la televiziune
  • Elena oooo melnic e foarte bravoo
  • Radu la cei care se încarcă greu, sunteţi din moldova ori nu?
  • Ion Florida - Ruslan Taranu, Prince , Pasha Parfeny, si Alex Manciu
  • Natachyka Ca la moldoveni...
  • om hai ca ii bun ... in sfarsit prezentatori adecvati
  • Мулю Ап пи щини вотэм? ЭМО-кончиные, Пе педикул-Парфени ку гэиниле сау пе Тарасюк ку Оноже?
  • Florida multumesc Ion
  • usa eu din usa
  • Natachyka Alex Manciu Nu a avut un stilist ca oamenii
  • Spectator damon))) fuuuuuu delooooc satanistu!!!
  • guest_155 da aista cu gel izmazanyi parca venit din timpurile o zone
  • guest_200 este vreun prost care sa voteze?
  • Azur Prezentatorii tre sa inceapa cu niste cumatrii ceva !!!
  • winnie the pooh ”sauna verde”. se poate înțelege de ce-i saună, dar nu se vede deloc că-i verde
  • kkkk oo bojee are unghiii
  • y ce ghiare are xDD
  • guest_195 Doamne fereste ce palit
  • d man's fake nails ,pizdetz!
  • Me fuuuuuuuuuuu
  • Spectator manichiura?
  • guest_155 fuuuuuu ce unghyiiii
  • eu fuuuuuu are manikiura :@ beah
  • grigore facepalm
  • Florida oau ce manichiura are Ruslan Taranu
  • El Pokynhauser "Atentie la pasarica' :D
  • pasarica melnic, bravo!
  • lynka eu nu inteleg chiar olaeac mai vesel si mai interesant nu se poate
  • guest_155 sunteti foarte colorati astazi mai ales nigga
  • kkkk fuuuuuuu
  • eu tashi tarasiuk ))
  • zayka numnai moldovenii pot fi asa' colorati 'cum a spus
  • Spectator bravo!!! stii romana pe 10!!!
  • guest_155 vorbeste pe romana oaieeee
  • muhha dak nish citiva oameni competenti sa prezinta , off ...
  • kkkk fu bline
  • guest_117 fuu... rusofoanca!
  • guest_200 Tarasiuk nu merita doar pentru faptul ca nu stie sa vorbeasca normal
  • Anastasia Taranu comparat cu Deimon....Ei au minte??
  • victor eh sa mai vb romana o votam poate
  • eu onoje!
  • kkkk parfenii kit d kit normal
  • Suruceanu e bravo Pasha insa show-ul slab de tot
  • kkkk restu ,fuuuuuuuuuuuu
  • Florida ce parere aveti de parfenii?
  • Anastasia Parfenii e preferatul serii !!
  • Natachyka Ăştia chiar sunt deplasaţi...
  • Anonim :d
  • Мулю Яти ши педику ку гэинили... Фупля!
  • Elena putini privesc soul
  • winnie the pooh lui Pasha nu-i este rău deloc :D e bravo
  • shii' asta numaaaaaaaaaa rusashi
  • Natachyka Da ce fete în RM nu-s?
  • victor iiiiiiiiii baranu cite fete in MD, da el
  • guest_186 Ирина Тарасюк и Гуца, молодцы
  • ZZZ Parfeni e cat de cat ok..
  • guest_141 votatine :D
  • Puff pam pam... accent de Moldova.... :)
  • Someone parfeni calare pe o fata ...
  • guest_155 irina deshovaya
  • Рома Ирина Тарасюк и Гуца, молодцы!!!
  • andrei votatine... :D
  • Azur si sa le si sa le !!!
  • VVV mda viteza nu-i raportat na calitatea orgaanizarii concursului nu pricep nimic si sunt numai 860 de vizualizari asa-i la toti?
  • Me Manciu cel mai bun!!!
  • Рома Пэй, дуте акасэ манчу!
  • kkkk numa cintareti ,da nici un stilist normal kare sai imbrace,nici un coreograf normal kare s faka ceva legatura la muzika
  • marinno 862 deja =))
  • ZZZ manciu slabut...
  • andrei kirilika roma :D
  • Florida mai da femeia asta a lui manciu peste tot se vira.....la toate televiziunele
  • victor cred a patit ceva sarmanelu la git
  • guest_61 900
  • Рома кирилика????
  • shii' asta dar shi Tarasiuk asta engleza vrea sa bijbaye dar romana nu vrea...ap' cum s-o votam
  • Natachyka Fără ea nu se poate
  • kkkk da da ,peste tot, da stai akasa fimei draga
  • Natachyka e teme să nu-l piardă
  • andrei da :D
  • guest_155 a4karik hrenav
  • guest_61 merge foarte greu
  • Suruceanu Unde au gasito pe domnisoara in albastru, nu prea poate vorbi dupa cite vad
  • Florida aha
  • kuku daaaa,,,merge 47 ș gata.
  • guest_155 paralela 7 oi 47
  • Spectator realina a4karik
  • Natachyka De unnde au scos prezentatorii?????????????????
  • Radu poate merge greu la cei de peste hotare
  • Spectator din cur
  • eu of, ce stangaci mai santem
  • d pentru synops!!
  • lynka arde shi???
  • marinno creshte numaru de vizitatori si incepe sa frineze kiar shi in MD.... dar peste hotare?! -_-
  • kuku din subțolu trm
  • clau amuş mai sărim în sus cu cei de la 47
  • eu slab trm......da bani o cheluit cu caru
  • guest_155 ooo eaka oameni normali!!!
  • kkkk casting bun :D
  • El Pokynhauser Iata cei de la Paralela47 is unicii de anul acesta care merita suport
  • usa da greu Radu
  • guest_103 arde porcu
  • Мулю Гавариць па-русски... кэ пахожэ кэ Тарасюк ши Гэинили луй педику-Парфени ну вэ ынцэлег
  • Spectator tipa it burns!! rupe!!! жжет!!!!!!
  • kkkk au glasuri de fuuu prezentatorii
  • andrei kum a aratat fuck kind numara :D
  • guest_158 ei ca voi nu faceti greseli ...criticati mai departe
  • kkkk mai bine raminea Diana Rotaru singura
  • ion merita , cintec destul de bun locul 10 -15 garantat
  • Radu nu e pentru eurovision cântecul
  • shii' asta rusashii il numesc pe Onoje "obezyana", iar pe Gootsa "maladetz"
  • guest_61 sigur, cei din Moldova pot privi la tv
  • Ion talentati baietii acestia
  • Huipedro buna seara tututor :)
  • Victoria Go, go, go, Alecu! ! !
  • eu show moldovenesc...plictiseala mare
  • lynka nu shi amuia , Diana Rotaru era mai interesant
  • Florida da va place de bunicile care merg la baku din partia rusiei?
  • dukaty artistii nostri, cat si prezentatorii ar fi bine sa invete a vorbi mai intai...
  • muhha mm, frumos cintec , prestatie buna
  • guest_10 alecu esti bravooooooo
  • Huipedro ce voce au astia =)))
  • behappy omg ..cu asta vrea sa cistige???
  • FourWays Vad aceleasi comentarii ca si seara trecuta la Eurovisionu' Romania. Sa mai zici ca nu suntem acelasi popor. :))
  • Azur cu regret,dar ii mare *ikat pina ce!!
  • sel scad vizualizarile
  • nata paralela 47 ardeeeeeeeee
  • Natachyka Ăştia au voce, dar cîntecul nu trage de Eurovision
  • eurovision mai bine iesea bunica sa cinte si aceea cinta mai bine
  • iulia acesta mai tare trebuie sa sufle in microfon
  • Marka FourWays dap :)
  • Мулю Аста е счена де 1 000 000 де доларь?!!... щинева де ла ТРМ о сэ алягэ ку ун БМВ ноу
  • eu nr 5 out...nii rau :d
  • Anonim hai faceti la vale k arde ))))))))
  • Elena e usor sa scrim si sa crticam numai esi stiu ce emosti au in fata amilioanelor de oameni
  • andrei nice rock !!!!
  • Anastasia ce piesa...nu-i pt eurovisioooooon(
  • andrei kit de kit merge
  • Huipedro slab paralela...
  • marinno shap lumea se mira kum de tinerii nu asculta muzica autohtonaa...ce sa ascultam????? =)))
  • Elena asa ca ahaideti impreuna sai incurajam pe toti
  • Elena si nu le uram succestse mari incontiunare
  • Someone e puna piesa .. dar nu si pt Eurovision
  • shii' asta paralela are o muzica ascultabila, dar nu face sa dam bani publici ca astia sa ne reprezinte.........
  • victor e buna dar nu pentru EV
  • lynka au incurcat scena
  • corina sexy!
  • andrei nu e pentru eurovision da merge
  • ion pasha parfeni a cantat?
  • kkkk dupa parerea voastra ce kintek,ar trebui sa fie la eurovision?
  • victor citi de multi sunt de o parere
  • guest_98 gootsa the best
  • Spectator Elena, atunci de ce mai participe? sa participe cel care e pregatit, care e sigur pe sine....nu mergem la joc de noroc...
  • hhgj ce cintec fu
  • sel fuuuuuu.......daca e prezentator,ap de ce mai cinta intr-o trupa,vocea lui e doamne fereshte...
  • madalina imi place
  • kuku guțî,,asta tu scrii?
  • Natachyka Da, a cintat pasha
  • Florida cinei kiokia?
  • El Pokynhauser #Мулю, am auzit ca podeaua-i din piele de crocodil
  • zayka si clovni daca vreti
  • ion hos that kioki?
  • sel ion,pasha a cintat
  • guest_61 :)
  • shii' asta numa' ruussshi
  • ZZZ iar rusa?!
  • Natachyka ???????????
  • marinno kiokea,govori celove4enim iazikom =))
  • grigore xunta
  • Ирина Тарасюк болейте за нас! Мы лучшие!
  • Florida fuuuuuuuuuuuuuuuuuuuuuuuu
  • Me Paralela 47 au ceva potential ..
  • Spectator Copy Kylie Minogue in stil retro
  • guest_195 wtf??????
  • ion fu blya nahuia eaka asha makiaj????
  • kkkk ahaha
  • andrei normal cintecu
  • guest_98 ksenia nikora fuuuuuuuuuuuuuuu
  • FourWays lady gaga !!!!1111
  • Sergiu da
  • marinno oo shi volum au :D
  • El Pokynhauser shine esti wa ?
  • grigore xynta
  • sel de ce te prikaleshti irina?
  • shii' asta iri'naaaaaa vorbeste pe normalino!!!!!!!!!!!!!!!!!
  • ion irina idi v jopu!
  • eu off,realina nii rau ....asta tipa ii muzika?
  • Natachyka Extravagantă KIOKEA????????????????
  • guest_195 marinno :D:D
  • guest_159 I spik ze englij languaj
  • Florida fuuuuuuuu
  • eu in ce kimba cinta?
  • ion ms pt raspunsuri, si cum a cantat live? piesa imi place cred ca voi vota pt el..
  • cica porecla blea si asta-i muzica?
  • Crawford beaka
  • shii' asta ce accent in engleze...ce gainarie mai e si asta? beahhh
  • andrei pina ce normal mie imi place dar nu e pentru eurovision !!!
  • Huipedro ingrozitor.... mi-i rusine.
  • lynka circ nu saga
  • ion irina tarasyuk vorbeste romaneste kioki!
  • Ion cine e asta?
  • cica porecla asta-i muzica ????????????
  • guest_158 nu inteleg nimic ce zice ... =/
  • Natachyka Asta de unde a mai ieşit?
  • Tatiana Parca-i Angelika Varum :)))
  • Ion Varum de Moldova?
  • victor maria mirabela
  • Eugeniu adorm
  • 1 Uite la ea si de numele de familie se rusineaza, dar a avut unul atat de frumos Nicoara
  • dfg plm piese mai bune nu au?
  • hhgj da pina ce nimeni nu mia placut
  • Florida :dd
  • guest_41 cu o cheama
  • nata si-a facut sprincene ca la vaca,e cam vulgar p-u asa cintec
  • guest_213 arata ca o combinatie de alla pugaciova si lady gaga
  • sel Shi Lady Gaga arata mai normal
  • Spectator curva de moldova
  • marinno @cica porecla blea, ei da....asta-i teatru =)))
  • guest_98 na fost niciun cintec asa bun pentru eurovision
  • shii' asta lisin ti di saund
  • Olga fuuu ce voce aiurea
  • FantomAS scena de 1oo de lei
  • Natachyka ştrampii îs super - bi
  • sherlock dafuq is this?))
  • andrei da :D
  • olguta27 guest_213 ai dreptate:))
  • irina O Doamne, ce soi de Gaga ratat!
  • guest_56 correct..
  • ZZZ afara rusofoanco!!!
  • Florin CocoShanel Moldoveanca :D
  • sel anu ista numa proshti cinta
  • Miha nici nu inteleg ce canta in engleza ei ..
  • cineva.. doame.........astai piesa pentru eurovizion ?
  • Eugeniu dolby suround
  • guest aiurea, nici voce, nici interpretare, nici infatisare!
  • ion cascaval wash nush ce
  • adelush shi bay cu babornitza asta....
  • eurovision cinta sub nas mai bine ar tacea de tot
  • Florida sa urcat sus,ca sa nu danseze ca probabil ncii nu poate
  • victor bai da precis e engleza ??
  • guest_215 doamna sa mai invete engleza
  • iulets iiiiiii.... a la anjelika varum sau cum?
  • 123 wtf cauta asta pe scena?
  • cristi Cred ca Pasa Parfeni pin amu o fost mai bun din toti si cintecu
  • Anonim jos komunistii
  • marinno kum de o ajuns in finala?!?!?!
  • guest_242 :D jesti
  • shii' asta parashaaaaaaaa nu eurovision
  • kkkk evrifing kar4oe
  • guest 12 iau ce bine ca se poate comenta
  • andrei wtf? si ku kintisili estea?
  • shii' asta sa sa duca la Euroasiatic vision
  • kkkk oo nivinaia ove4ka
  • Puff totuşi, atunci cîmd vrei sa cînţi în engleză şi ştii că ai probleme - poţi lua cîteva ore de engleză....
  • kuku da,,jos cumuniștii))
  • marinno oo akush plingem oleak =)) pleaa..tot inrusa
  • anonimloh anonimloh
  • cristy numai la mine? sau asa peste tot merge? cu intreruperi?
  • sel poate asta cinta mai normal
  • eu offfff de unde o iesit???
  • victor RT kukuda,,jos cumuniștii)) :D:D:D:D
  • sherlock numai "tarani"
  • eu de unde atatia rusi???????? kiar nu-s oameni care stiu si romana si sa cinte?
  • sel numa kai rusoaica
  • ZZZ sus comunistii! sus in tzeapa! :D
  • ion fuuu rusofonkaaa!!!!
  • Natachyka poate
  • Tate Eu nu cred.
  • anonimloh loh
  • grigore jios aliansu
  • guest_61 cred ca la toti
  • olguta27 la mine fara intreruperi
  • y da noi avem limba de stat sau nu?
  • guest_213 am intrat mai tarziu, spuneti-mi va rog Nicoleta Gavrilita a cantat?
  • shii' asta jos comunistiiiiiiiiiiiiiiii
  • andrei sel aha am vazut... :D :D :D D
  • cristi la mine tot cu intreruperi ((
  • kuku pe trm e fără
  • guest_36 ei pipets....
  • Nicu pana acum cel mai bun a fost Irina & MC Gootsa
  • FourWays Inca nu.
  • sel guest,nu nu acintat
  • sherlock 213,nu,inca nu)
  • muiemata no cantat
  • nata acesta e un cintec bun,voi ce ziceti?
  • Tate Rocj=hia e frumoasa.
  • Huipedro uite ma ca nu-i chiar asa rea blonda!
  • 1 inca o rusoaica...
  • adelush brilliant voice. bv bv leria
  • cristy sunt in strainatate, si tare vreau s ama uit, dar se intrerupe
  • victor cum o kiama ca nu am reusit sa vad???
  • hhgj la noi nu se respecta limba de stat
  • Nicu Nu a canta Nicoleta
  • guest_49 nu-i rau..
  • guest_126 nub a cantat dar chiar o astept pe Nicoleta G
  • marinno limba de stat este numai in Constitutie shi gata,restu numai RU
  • guest_98 nicu is deacord cu tine
  • guest_213 sherlock, merci:)
  • cristy da transbalkanica a cantat?
  • usa Bai undei Pavel Turcu???????????????
  • shii' asta irina si googootsa is doi kakanari de la nit de-ai lui Dodon
  • Florin uuuuuuuuu
  • andrei bai ma duk pina la viceu ka nii a varsa kind ii vad :D
  • sherlock cinta frumos,dar arata nu chiar bine))
  • adelush apreciati vocea nu ce limba vorbeste
  • FluBBeR ”restu numai RU” mda.. cea mai mare problema...
  • sel mdaaaaa,fuuuu
  • Natachyka Asta cît de cît e stilată
  • kuku haha,,ban
  • spectatoor si mai tipaa
  • eu ce cacat e irina si gootsa.
  • guest_122 kind vom avea presedinte,vom avea si cintece normale:))
  • white cand e randul Nicoletei Gavrilita?
  • guest_10 in green room tavanul este plin de mucegai. la tv se vede foarte bine
  • guest_215 da ei nimeni nu stiu engleza
  • guest tare buna coregrafia. ati vazut-o pe dansatoarea in alb imbracata? :))) fu!
  • Tatiana Bolocan, tu pentru cine?
  • andrei deja suntem 989
  • van damme mai ghini ma duc sa ma uit un film cu Jackie Chan
  • shii' asta cum sa apreciezi vocea daca za ingleesh is veeri beeed
  • sweety cinei blondinka asta?
  • Sirghi xd
  • y mdaaa..
  • ZZZ Leria canta frumos, degeaba va aninati de ea :)
  • florida Hai so votam pe Mihaila ,Mihaila pentru presedinte
  • lynka merge piesa asta dar se putea ceva mai vesel
  • shii' asta da
  • guest_93 bravo parfeni
  • Me eu aștept să evolueze Human Place
  • kuku iaca adminu amu se veselește)
  • ion ceva are cintecul ... merge
  • victor vseo esti libera ! ! !
  • eu slab
  • Sirghi Transbalkanika
  • Nicu Parfeni are cantec bun insa nu mia placut ce a facut pe scena
  • Radu de ce mă veselesc?
  • Natachyka Aiurea in tramvai
  • andrei iara mdleag
  • sel iaka shi croitoru
  • Tate omg!
  • Lenna Dara are piesa frumoasa
  • adelush kuku cuumva esti tu admin? vadca numai de ban vorbesti :D
  • winnie the pooh să vedem ce face live
  • lynka aha
  • spectatoor ooo, cristinaaaa
  • Sirghi cine-i bolocan?
  • eu am impresia ca o a trecut in finala cei mai slabi
  • asd booootex
  • j Transbalkanika- macar au muzica profesionista
  • sherlock iata croitoru are piesa cit de cit bunisoara
  • tina de ce oamenii cred ca ei pot cinta?
  • guest_10 la TRM avem niste prezentatori vai de capul lor. degeaba iau salarii din banii contribuabililor.
  • guest_169 Lenuta Burghila va canta?
  • mindfucker mii rusine de prestatia acestor "artisti"
  • hhgj imi place cristina bravoooooo
  • eu asta are ce are cu rosu
  • j da si IOn Suruceanu tot
  • Tate Mdaaaa... rochia e buna.
  • eu asta e oleac mai melodic poate fi unu din primele 5
  • andrei asa cintese nau si kauta la eurovision
  • 1 Prezentatorii ca si canalul... din pacate
  • victor domnisoara piesa e buna dar nu de EV
  • ZZZ Transbalkanika inca nu a cantat... vedem ce show o sa faca ;)
  • Nicu Da cantecul e bun
  • florida da ea sa ingrasat sau mie imi pare
  • D. @ eu korona :D
  • nata voce frumoasa live are cristina
  • Natachyka Proidenîi etap cu stofa în vînt
  • cineva.. superba poza
  • lynka frumoasa piesa
  • zayka azi toti in rosu, e prea agresiv
  • victor mai e buna
  • sel bunishor
  • guest_58 poti sa-ti iai cuvintele inapoi deja
  • iulets ooo, ceva mai bunishor parca))
  • guest_111 numai odat?
  • f_89 pina la urma tot va cistiga ,,NUMELE,,.. nu cineva pe care-l vedem prima data ..si nici n-avem ide cine-i
  • cretzulea in piesa gata croitoru cinta mult mai bine, dar aici e asa si asa
  • dokk ++++
  • tina cit de cit....
  • j frumos da prea-i de jele
  • Me eu-s me
  • guest_193 acum cinta invingatoarea ... tot respectul pentru piesa Nicoletei Gavrilita - insa asta e mai buna
  • irina Croitoru, mai aduce o raza de speranta.
  • ZZZ mie nu imi place. e mai buna decat altele, dar nu merita sa ajunga mai departe.
  • florida va cistiga cine a platit
  • andrei balet BL...
  • guest_98 croitoru the best
  • guest_10 moldavschii evrovijon
  • guest_158 Fato ,ti s-a aninat fusta de ventilator ...o sa te impiedici
  • guest cintecelul e bun..
  • Me ma vez?
  • Tate Merge, dar nu la Eurovision.
  • Sirghi cintece de aeste prea des rasuna la eurovision si nu prea au sanse
  • vasilica dansatoarea imi place
  • andrei :D :D :D am vazut
  • adelush ti vad :D:D
  • tina da mie imi place cum filmeaza ai nostri e destul sa fara o saritura mai indrazneata fata si toate camerele sunte pe sundul ei)))
  • Sirghi Pe mine ma rupe cine se duce de la Russia ))
  • hunya Varza piesa, pentru babe
  • FluBBeR te vad șd
  • Natachyka Hmmmmmmmmmm, ieftin
  • j parca v-am spus transbalcanica - asa am hotarit dupa ce i-au ascutat ieri pe toti prima si utima data
  • dokk cintec bun dar europa cu elnu cuceresti
  • Solnishko :D...ce piese are ea ...si cu ce a venit azi la Eurovision ....
  • lynka dfg conteaza pu Bacu?
  • Me maladeț
  • andrei la voi lag la cheat?
  • eu putena relaxare!!!! publicitate
  • Nica Adrian Ursu a fost?
  • guest da, babulki rules la Rusia :)
  • hunya Si publicitate peste fiecare cantec. Eveniment pentru turma.
  • Tatiana Bun Croitoru
  • guest_220 pana cand parfeni a inpresionat..piesa pt ev e cea m potrivita...da rochoa crisinei e buna de tot..de altfel,si piesa,doar ca pt ev trb ceva cu nerv..
  • FluBBeR asta el nie nio scris dak il vad xD
  • guest_122 asta tv nationala cu publicitate in rusa
  • Tate Common! Publicitate...
  • Goga O racit mi se pare sup fusta =)
  • lynka nu
  • tu m-ă știi :d
  • Natachyka N-a fost Ursu
  • Sirghi xd
  • Nicu Adrian e la 13-lea
  • j Adrian e la ciocana cauta apartamentul cela
  • sweety da mai vorbiti unii chiar ca taranii))
  • Nicu Da rusii cu babele lor cu tootul siau iesit din minti
  • f_89 principalu sa nu moara vreo una din babushte pina la eurovision :D:D
  • buburuza cat costa mesajul pentru vot?
  • ZZZ Adrian etno ursu?:)) asta ziceti ca poate canta pt eurovision? :))
  • hunya bred sabacii da nu eurovizion
  • cretzulea nu imi pot imagina cine va cistiga
  • Solnishko dap` cn se duce de la rusi?:d
  • Me V for Vendetta
  • guest_126 imi place comentariul cu ventilatorul:D
  • Puff :) deocamdată e mai interesant să citeşti chat-ul decît să vezi ce se face pe scenă...
  • alex Croitoru pe departe cea mai buna decit restul
  • guest_122 da ,babele rup
  • iuh ce vorbiti ca ciobenii la stina??????
  • hunya Nici pe Pavel Turcu nu l-au chemat
  • Sirghi da babele o sa ocupe loc buna , anume de umorul de pe scena)
  • consateanul cine cistiga_?
  • stells mda, ieftin eurovision
  • eu acum merge reclama ca piinea calda...
  • Gicu doamne unul mai rau ka altul poate de la Akord va fii ceva :(
  • consateanul .
  • cineva.. ea are foarte bua voce, pina acum doar ea merita
  • guest_122 pavel turcu va inchide programul,ca invitat de onoare
  • porecle ce-i cu bufferingul ista wai ?!?!?
  • hunya fara Pavel Turcu orice eveniment e destinat sa fie un insucces
  • md cea mai proasta selectie din 2008
  • buburuza doamneee..atata pubicitate.....
  • Nicu babele din Rusia vor lua loc bun numai daca vor vota pensionarii lui Voronin
  • cineva.. scz am vrut sa spun buna
  • Solnishko iaka piesa asta o cinta cristina(korona) ...da ...asta`mi place...da care azi la evr l`a kintat....Pfff.....nu`i p/u evr la Baku
  • Nica mi-i interesant Asrian Ursu daca o sa cante cu fular, mai pe scurt ce show va face, ca, cu cantecul cel putin e paralel.
  • Puff dintre tote piesele de pînă acum aş vota pentru cea din spotul publicitar de la Korona.. :)
  • Cyoaparteala oooo pavel turcu e cool man
  • milly am ierdut 1 ora de eurovision a fost ceva interesant ????:(
  • arji cum credeti ce sanse are Transbalkanica?
  • hunya 8000 de sponsori are eurovizionul si toti au donat cate 5 lei
  • Puff :))))
  • victor :D :D deacord Puff
  • Natachyka fuuuuuuuuuuuuuuuu
  • Solnishko stai linistita ...nmk bun :D
  • buburuza + votez pentru ciocolata Korona
  • cineva.. nu
  • j Baku frumos(daca ai bani) si tare cald.
  • Natasha` nu chiar..
  • guest_12 milly,deloc
  • guest_161 ce microfon frumos are prezentatorul :)))))))))
  • guest numai Pasha Parfenii:) nimic n-ai pierdut
  • guest_122 milly poti sa te mai plimbi o ora
  • Natachyka bîlbe
  • hunya oooo, acikariku de la chto gde kogda
  • victor mai ce prezenytatoare leviii
  • guest_26 dfg, doar prostii ați învățat la școală?
  • j reclama e in rusa ca ei au bani da astlalti mai mult cu lucru
  • Kim Ce-i aici??? :))
  • mava pur si simplu piesa Cristinei nu este pentru eurovision.Da vocea ei e foarte puternica si frumoasa.
  • Natachyka cînd îi auzi cu green rum...................
  • olguta27 guest_161 nici nuobservasem microfonul e nostim si deosebit
  • Sirghi xd
  • andrei da ruummmmm..
  • Cyoaparteala nush da pine ce e de nota 0 eurovijon :D
  • ZZZ bravo 47 :)
  • f_89 ooo daa...asta cu green room ..
  • Irina La toti sunt intreruperi in transmisiunea asta, sau numai la mine merge greu ? :(((
  • maicuta este mult de muncit mold0va pu a ajunge unde vrem urit...
  • Natachyka poti să-ţi inchipui că chiar i-a venit acest mesaj
  • hunya shinii Pugaciova asta botoasa?
  • guest_122 inafara de facebook si boxe ca la nunta nu s-a schimbat nimic
  • vasilica Victor - tu esti levii, padrujile sint ceotkie !!!
  • zayka prostacvasino
  • buburuza prezentatorii sunt penibili..reclama in rusa... bheaaa
  • j green de la "verzi" adica neajesi probabil
  • Nicu Ce vopsite
  • dfg j n-am învățat numai prostii... numai că ce am scris a fost un fel de exprimare :P
  • andrei jocker bl..
  • Nicu vulgar
  • xodibox da unde-i green
  • nata transmisiunea e ok
  • guest_32 ce-i cu teatrul asta???
  • f_89 un fel dze scena )))
  • Cyoaparteala hahahha o speria aista :D
  • Serii :d
  • Natachyka pugalo
  • guest_122 la mini sunt intreruperi doar cind inchid urechile:))))
  • andrei greeen asta florile
  • andrei "D kaiiif :D
  • Cyoaparteala kaif :D
  • sel kaaaiiif
  • victor concinaia
  • Nicu Nici nu pot vb in romana
  • guest_219 de ce nu pot să privesc?
  • Tatiana of doamne :D
  • Nicu rusine
  • guest_122 ruuuusine!!! rusooo
  • hunya vipliuni clen izo rta, govori po celoveceski!
  • j dfg? alege pe altii care pot alege ce trebuie - unica solutie
  • guest simpatica totusi
  • svetik ce vocabular au Moldovenii nostri rusine
  • Serii Kaiff))))
  • sweety hhhhhhhhh
  • hhgj mare cintareata
  • Natachyka Se vede pe el
  • Cyoaparteala asta se vede ca a baut redbull :D
  • guest_8 valeu
  • eu asta seamana cu cristina........:D
  • Serii Comanac , ti-o tupt?)
  • haha: bunisori))
  • zozea valeu
  • alex leria... invata romana
  • Irina Haha, perfecta intrebarea
  • victor proastooooooooooooooooooooooo
  • eu clar ca glumeste
  • guest_32 super intrebare !!!!
  • betty :)
  • ew de unde si asta e?
  • Elena nu mi-a placut nici o piesa de pina acum :((
  • Nicu leria rusine
  • lerka ii
  • Nicu rusine
  • wizzzzzyy cica Ruslan Taranu seamana ku Damon de la Vampire Diaries..)))) off
  • Raul chiar si in prestatiile anterioare am fi putut vedea gay.
  • andrei sinii o dat intrebarea ? rupee
  • victor cristina cea mia buna pin cind
  • dokk durda
  • florida grasa
  • Cyoaparteala ii cade rochia de pe sini "D
  • ZZZ Leria a invatat in Rusia, asa, ca printre altele... si a cantat la rusi in romana...
  • dima la mine nu merge
  • guest_219 de ce nu se încarcă?
  • guest_30 tret
  • 1 da si prezentatorul "se pune"
  • hunya ooo, iaka asta in roshu are marfa!
  • guest_122 aratati-o de jos nu miskati camera atita
  • andrei :d
  • dima 211 la mine nu merge
  • Cyoaparteala :D so gruzit boris
  • guest_97 e bine in spatele irinei...
  • KOKO FUuuuuuu, rusine chiar dezgustator
  • Nicu hunya sa inteleg ca tu feliciti babele din rusia
  • kira Cam grasutza Cristina! Ce s-o scapat la mancare inainte de eurovision or ce...
  • dima 211 la voi
  • buburuza tzaranism, dar nu eurovision
  • Solnishko nu merge...dc? :d
  • Serii ''are un spate ,Doamne fereste'' xD xD
  • eu doamne fereste....
  • guest_87 bleah, buffering nah... cu 50mb internet , shoza huinea
  • alex prezentaorul e prost...raaage
  • dima 211 hekkku
  • ZZZ fuuuu... urat croitoru!!!
  • KOKO sper urmatoarele piese sa fie mai OK
  • milly glumetz si pervers prezentator .:DDDD
  • florida oohhh
  • Cyoaparteala doamne asta ce e urita :(
  • haha: kira ea sa ingrasat de stres ca si Lupu:D
  • guest_158 citi participanti sunt de tot ?
  • sweety fuuuuuu,mihaila((
  • s.b. Cristina a cintat foarte bine,chiar e o fata simpla si draguta ,iar cintecul e super tare in comparatie cu altii!
  • dan tu esti prost
  • kuku toți sunt gata?hai9 trimit sms pentru asta
  • euuu oooooooooo stati atenti urmeaza bomba
  • kira opaaa si marisha
  • andrei phhh si gitara nu ii ajunge
  • shoimarel la mine merge super
  • Tate Oh, ce-i cu fata ei?
  • guest_48 mdap...si la mine merge greu... si io care credeam k e de la net
  • guest_155 oh god whyyyyyyyyyyyy?!
  • solnishko pppff....noi cu ashe piese plekam la eurovision :(
  • dima 211 la voi merge
  • Nicu Cantecul Acord e mai bun decat asta
  • INNA back vokal superrrrrr
  • sherlock taranacika
  • ZZZ zvezdeta!!!
  • guest_219 nu merge de fel
  • alex marcel spataru...respect!!!!
  • Serii nuu.. Transbalkanica
  • grigore cat de primitiv totul....da totul
  • Cristina) ooo Mihaila,..phahah
  • guest_219 nu am idee ce e
  • Me oh god whyyyyyyyyyyyy?!
  • sherlock strasnic
  • Elena oooo da ce dea sustinatori are
  • Cyoaparteala hmmm ian amu ce ablom va fii :D
  • eu o slaghit cam repede, mariana
  • Elena mariancica a noastra
  • dima 211 la mine nu
  • Fuuuu sii cu krisa asta
  • Suruceanu ooo acum, citeva minute de taranism
  • euuu aaaaaaaaaaaaaaaaaaa
  • kuku http://www.nooooooooooooooo.com/
  • buburuza ma impusc )))
  • white cand e Nicoleta Gavrilita?
  • Irina gata, nu'mi place
  • miorita si asta-i scena de 1 milion dolari?
  • andrei omfg omfg omfg :00000000
  • guest_122 si-i cu skindura asta?
  • euuu Toefl
  • guest_40 :D shi priceoska
  • florida taranism suprem
  • nata fuuuuuuuu
  • Nica la mine merge bine. ptiu,ptiu,ptiu :)
  • lol cu ce a gresit Moldova noastra ,Doamneee????
  • hhgj foc
  • zozea opareala
  • tu m-ă știi fuuu
  • ci cine credeti ca va cistiga in seara asta?
  • guest_242 wtf :ssssssssss
  • guest_158 fail!
  • wizzzzzyy give me a gun
  • Natasha` axaxa
  • ZZZ cine are un glonte in plus? :))
  • andrei eu am pus pe mute
  • stells numai mu ia nu are talent deloc
  • Tate Ooooo.. unde e butonul STOP?
  • 1 da...
  • Sky Mother of God
  • victor mai si nu poate cinta ce a mai venit
  • kira Doamne fereste!!!!!
  • Cyoaparteala omfg nooobs
  • Puff ... e nevoie de subtitrare :)
  • dima 211 va uitati in direct p ee net la eurovison sau la televisor
  • Raul Ce panza io frecat de fata!
  • alex fuuuuu
  • zl ceaccent timpit in enleza.... ca de la tara )))
  • kuku eu mai ghini cînt,,,sirios!!!
  • f_89 :D:D.... da mie comentariile imi plac )))))))
  • Spectator illuminatti!!!! triunghi....in iad cu ea!!! dute de aici proasto!
  • Olga hahaha mai nu io zburt microfou
  • kkkk ahahaha
  • guest_155 dugso ii director la eurovision numai de asta a trevut c**** asta , nici nu are glas
  • guest_48 uh ti...m`o luat fiorii :D
  • Cristina) impuscati'o
  • ngelish Ana Gulko a cântat deja?
  • guest ce? e mai apetisanta asa slabanoaga decit Cristina Croitoru, baieti?
  • kkkk piata centrala
  • sweety manciu the best
  • Nata Buna seara!
  • winnie the pooh mai nu i-a zburat microfonul ))
  • Cyoaparteala zubacistkii :D
  • zozea catastrofisma
  • Marka imi pare mie sa fata nu prea poate canta in engleza
  • eu priceoska ca la o vampir..
  • olika nu e buna piesa pentru concurs
  • :) cum ave sa-i sara microfonu
  • fedea i-o ff.ut un microfon in bot
  • solnishko am observat sh eu .... k mai nu raminea fara mikrofon :D
  • Lilia Vai de capul ei si de engleza ei...
  • hhgj ce voce si ce imbracaminte
  • Miha asta ce limba ? :D :D :D
  • Inna Toti sunt buni, dar nu pt eurovision!!!
  • wizzzzzyy (white)Gavrilita e a 11a
  • Elena dupa juriu sa ne luam va cistiga pasa parfeni
  • Elena ce zice
  • iulets looooool :ddd
  • Alex Mihailă la gunoi!!!!!!!
  • Elena merge el
  • 1 parca canta un cantec popular de mama
  • sherlock Spectator, crede`ma ca nici macar semnele illuminati nu o sa o ajute :))
  • Elena sa ne reprezinte
  • olika nuuuuuuuu
  • milly sincer parcai elvis presley ..:D:DD
  • lerka:D:D iii...nu am cuvinte..eu ink ma pornem la concert..cic s privesk live ..tfu blin
  • las bleaa..numa nu asta
  • andrei parkai extraterestru
  • cuc mihaila, corpu mic si capu mare parca e extraterestru:))
  • Elena moldova la euro vizion
  • mindfucker bine zis piata centrala cine-o zis :D
  • FEELGOOD leva
  • sandu ce i-o tras una in fata :D:D:D
  • shoimarel :))
  • eurovision aiurea de tot cu engleza voastra mai bine invatati inainte de a cinta
  • ich penibili, incepand de la prezentatori, pana la Limba straina vorbita de insii care vor sa reprezinte Molodova
  • buburuza buna in loc de sirena pe masinele de pompieri )))
  • euuu stingeti lumina la telecentru
  • kuku vesel aiși...
  • dima e varza de tot...
  • Fuuuu ce cap mare are, si corp mic
  • haha: Alexandru Manciu va cistiga
  • guest_162 shi-i asta????kto zdesi??!!!
  • Cyoaparteala ppt ce coliba e din urma
  • Cyoaparteala :d
  • alina dar ceva mai ca lumea nu pot cinta
  • zl da, da, la gunoi cu ea
  • Serii nici o tmea...
  • solnishko :D:D:D strasnik....strasnik
  • zozea kklassna daca sheva
  • ngelish ana gulko a cantat deja?
  • guest_122 incercati sa inkideti calculatorul ,la mine nervii s-au resetat
  • guest_219 fuuu..ce aiurea cîntă
  • victor ohoooo
  • Cyoaparteala ahahahha no sa o scape e grea :D
  • shoimarel shi cacatzel de cintec are mihaila! :))
  • Topo OMFG!!!!!!!!!!! ce-i asta??????
  • kkkk ei kum fara asta la sfirshit ? :D:D:Dd
  • svetik dor de mama pe ruseshti
  • guest_159 palatca nahu*a?
  • zayka zombi
  • guest_164 are un accent de gruzin in engleza
  • guest_155 sh amush se incepe visiolaya grupavuha))))))
  • kkkk tsaranka bl*a
  • Cyoaparteala dc pe croitoru oare no ridikato asa :D ?
  • eu melodie 0 zero...show anitpatic
  • tu m-ă știi nii lene sa o ascult
  • eurovision faceti numa show de 2 bani
  • solnishko :D.....park`o kalkat`o ursu pe ureki :D
  • guest engleza lasa de dorit... si inca tare mult!
  • Nicu Mda si degeaba a luat ea a 21 loc
  • j Imi pare rau nu Mariana..
  • andrei rau ka nu is akolo in scena ka arunkam cu ceva in ea
  • hhgj de tot aiurea
  • f_89 nu trebuie de stins lumina ...ca se termina veselia
  • lynka da unde se face eurovisionul asta ???
  • kkkk mai ghini era dupa palatca
  • Suruceanu ha ha ha show tipic taranesc, nimic deosebit, ideii din anii 90
  • guest_215 omg
  • om ahhh mai ramanea so scape jos :)))
  • zayka are dureri de cap , edupa betie
  • Nicu din start acord trebuia sa l ia
  • Spectator sherlock , ea a sper(m)at)) ca directorul o va ajuta :D
  • zayka :d
  • Natasha` Nu-mi place cintecull!!
  • guest_230 brava. acum du-te de unde ai venit
  • kuku da acolo,,,cîț spectatori sunt?
  • arji :)
  • dima 211 hey
  • mujiku sii asta? :D
  • alina mai trebuie sa aiba si un traducator linga ele
  • dima 211 la voi merge
  • Fuuuu alt vinas mozga
  • florida mihaila cea mai bunanu o sa regretati,votatio doar pe ea ,merita
  • dima 211 pe net
  • ci rau ca pavel turcu nui
  • sandu cum se va lege cistigatorul?
  • Raul ujas
  • Natasha` omgg))*
  • dima 211 eurovision
  • shoimarel nica bun in tara asta.o tunat si i-o adunat!!
  • j Trasbalcanika mai degraba decat tot ce am vazut pina acum
  • dima 211 la mine nu
  • xodibox cu subtitre
  • cretzulea doamne fereste :(((((((
  • hhgj eu cred la eurovizionu asta o venit sa cinte cui nu ia fost lene
  • cuc Noroc de Anatol Melnic ca face glume, prezentatorii is nashpaaaaaaaaaaa
  • dima 211 stiti voi un site
  • M colaborare cu producator din strainatate?????????
  • ich oooo, mc fund
  • buburuza ahahaha..circul pe scena
  • andrei oo seva mai vesel
  • guest_122 fiti pozitsiviiiii
  • solnishko bl*a anu` ista nu`ma klovni :D pi`aishi :D:D:D:D:D
  • kuku hahahahaha,,,asta maik mudacu?
  • xodibox broashte
  • Cyoaparteala ua pa pu paaa uaaaa aaaa aaaa :D :D
  • lol shoooza
  • wizzzzzyy moll girl ))))))))))))
  • kkkk shi ku rokia lu asta?
  • haha: fuuuuuuu kaka
  • guest_219 jesti
  • kuku el vre la bacu!
  • Raul Cracanata asta de unde s-a luat?!
  • kkkk opaa
  • guest_32 aiureala
  • sel ce accent
  • solnishko engleza rupe tat :D:D:D:D:D
  • Tate Hahahahahahahahah
  • dima 211 hey cine stie un alt site cu eurovision on;line
  • mujiku ce huinea :) mc mike
  • ci la gunoi
  • Cyoaparteala ce cacioci in spate
  • dima ce oribil..
  • lena wtf?
  • Spectator deja a catulea an Jazz ne prokanalo?))
  • svetik care n-au avut ce face au venit aici sa cinte
  • Nicu cum au trecut ei preselectia??????????????
  • Marka opa si duricu ista, mare pevet :)
  • Tatiana mă doare inima
  • nutza omg...și bred
  • Spectator park hamaiesc cainii :D hhaaa
  • dfg =)))))))))
  • guest_159 lol))))))))))
  • kkkk asta shi tipa nicki minaj? :D:D
  • sds fuuuuuuuuu
  • shoimarel mai ghini deam veneau niste babe ca la rusi.cintau mai bine precis ca toate fufele astea!
  • FluBBeR ooo ... iata si ceva mai interesant in sfirshit Ș)
  • cuc ce fignea..danseaza ca taranu
  • mindfucker ceeei cu astaaaaaaaa
  • buburuza clovn
  • cretzulea de unde mai este si asta pleteoasa???
  • kate_89 mc mike?)))))
  • natalia hai la nebuni... 3 la leu
  • eu eurovisionul arata fata reala a estradei noastre
  • sweety ce clowni aistea,phuuuuu,circ
  • lily doar piesa cantata de parfeni restu ii bred
  • gicu ha ha ha vreu shi eu costum din asta
  • Puff identic cu spiritul eurovision din Chişinău - SNOBISM ...
  • sel lu muzikantzi io pus mushki falshi
  • ahaha moooor
  • nutza înc așa tupistică nu am văzut
  • zl parca-s Gordienco cu Arsenium .... trash
  • guest_122 eu +10000
  • Dada Acuma-i criză de Pavel Turcu, fraților!!!!
  • Cyoaparteala sa scoata hainele cei din urma vor ramine ca niste bobici :D
  • Radu ham ham ham ham :)))
  • andrei 1 leu pentru show
  • mujiku ha ha
  • kkkkkkk :))))))))))))))))))))))parca-i bighimot
  • Nicu zbeara
  • M Next!
  • alina undes artisti de 2 ani in urma ca acestea ne vor da de pozor
  • kkkk imbrakatura ii ea
  • Raul O saika de retardati!
  • arji eu tot asa cred e mai original, toti parca fac teatru nu muzica
  • Fuuuu sii caciosi din urma :D:D :D
  • adelush oofff :D:D or de ris.. parkas la circ
  • dima 211 gfffgf
  • solnishko Sh noi ku asta ni ducim la Baku?:D:D:D:D:D Ne dam de pozor .....Pptz
  • Topo shooo zaaaa...fignea????????
  • wizzzzzyy cintecul imi aminteste de malinki(diskoteka avariya) anume unde baiatul cinta
  • shoimarel parca vad ca o sa plingem dupa pavel turcu
  • j pletoasa de la Ciocana Tatal de peste hoatere de tare demult in Moldova. Da cantarea...
  • solnishko bbbzzz....:d:d:d:d
  • stells pavel turcu mai gine cinta ca ei
  • Topo vine sa iau lopata si sa ma duc sa ma ingrop :DD
  • guest_230 nici la cumatrite nu's buni de cantat...
  • olika fuuu
  • iulets ei serios vor sa ajunga la eurovision? bitva tantsem.. serios
  • mujiku bicoz
  • guest_122 a estadei si a culturii si,in general ii hrenova de tat la noi,
  • Natasha` :d
  • andrei da :D
  • !! si fata cu costumul de la sex-shop
  • winnie the pooh back vocal e mult mai bun decît solistul :D
  • buburuza Pavel Turcu, unde esti ? :((((
  • zayka prea erotic
  • Irina lor nu le'o fi rusine la baku cu un cantec ca asta ??
  • Dragon nu știu de ce, dar astăzi a început să-mi placă piesa lui Pavel Turcu
  • Cyoaparteala doamne ce rushine ma shokeaza
  • Serii Pavel Turcu la ionica)))
  • lol we neeeeeed u Pavel Turcu
  • svetik ffffffffffffuuuuuuuuuuuuuu
  • sherlock i'm what?
  • kkkk nu se potrivesc,fu blin.. inkeets pidjaku k s vede PINCILI fuuuuuuu
  • solnishko de`am ni`i dor de pavel turku :d:d:d:d:d:d
  • stells in italia
  • j nu au nicio sansa
  • limon nu i-au nici u loc astia
  • Radu Irina, +1 :)
  • cena shit
  • alina tu vezi cas bune de pus in copac in loc matahala
  • lerka:D:D ea v shoke..
  • sweety imi trec tot traficul cu eurovisionul asta )))
  • Irina chiar, si eu m'am gandit la o tinuta sex shop
  • Sandu Pe cine trimitem la Eurovision????
  • mindfucker ua pa pu pa :D:D
  • Nicu in sfarsit sa terminat
  • eu costume . emitare LOrdi
  • ngelish bred total
  • Tatiana ei măcar se aud când cântă și ce cântă ...
  • maria sauna verde e ca si aista sare de parca ii ruki verh
  • buburuza Turcu, Turcu !!!
  • guest_122 pavel turcu ii scaparea(ca si lupu):))
  • porecle "fata" a uitat sa se imbrace ...
  • guest_155 477777
  • andrei anu nou o trecut
  • Irina Mda, Radu, mda :)
  • Topo Turcu vino si salveaza Eurovisionul
  • solnishko ooo....iara cv interesant :D
  • Tate Roma Zverev))
  • guest_230 Ierurovizioooooooon liume multa si frumoasa
  • guest1 eiii cu cine sa te duci la baku??
  • hhgj parfeni
  • Irina ey, nicoleta, o ador fata asta
  • white eiiii
  • kkkk oo,asta to4na ma enerveaza!
  • critina ujasna retardati :)
  • j cea mai mare bucurie ca deja au catat atatea si au ramas mai putini sa cante
  • haha: le pui intrun cires si maninci cirese tot anul imprejur
  • kira Nicoleta Gavrilitza imi place! are voce buna fata!
  • Petru succes Nicoleta
  • Alex kda ni smotri - numai bîși
  • M o da, fotka cu Zverev!!!! tare o sa ajiute:))))
  • Victor Solnishko..invatate sa vorbesti corect inainte sa critici..nu la Baku..dar in Baku
  • Spectator votati pentru ca sunt crazy????
  • eu inceput de drum....:D
  • Radu pentru ce la eurovision să fii crasy?
  • Tate da, da ea e precis crazy
  • Cyoaparteala Turcu unde draku esti salveaza situatia ca aici sunt toti crazzy :D
  • grigore votati nebunii )
  • guest_90 buna aceasta fetita
  • guest_210 da..ce prezentari ieftine
  • Nica ooo Nicoleta Gavrilita, amu-i amu :)
  • adelush votatio o zis cai nebuna :D:D
  • Cyoaparteala omg nam cuvinte
  • patnurush lookul lasă de dorit
  • zayka iar rosu
  • guest_122 j eu tot la asta m-am gindit
  • Pavel Turcu's mother si huinea
  • eu emitare germania.pinca cind se tine bine
  • alina la dinsele deabea va veni anul nou dupa paste
  • lol cine ii imbraca ???????
  • cena Unii invata 6 ani de muzicant si degeaba...
  • kkkkkkk nicoleta buna fata
  • limon o stiu pe asta de cind era mica de tot
  • guest_98 Gavrilita fuuuuuuuuuuuuu
  • tina oooo..... daaaaaaaaaaaaa
  • guest_214 normala fata!
  • andrei si tati in rosu parka is nisti jisini skoasa la vindut..
  • shutnik kakat de de caine de pe sub un tufar
  • ion Organizatorii trebuie mai intii sa priveasca finala nationala la suedezi ca sa vada cum se organizeaza un concurs normal,nu mai zic de participanti si vocile lor!
  • guest_230 edward scrissorhands?
  • tina vrea so faca pe katy pery
  • guest_90 fine rokita
  • Votam votaaam bai
  • Cyoaparteala ihuuuuu
  • ZZZ votati-o ca e nebuna! :)
  • solnishko :d:d:d:d:d
  • kkkk shinii imbrakaaa??? shiniii fashe asha ''frumoshi'' ??
  • cristina da nu na... sii ku asta?
  • tina in stilul ei vrea sa cinte
  • cena shit
  • olguta27 :)
  • solnishko Treb de`i legat miinile :D:D:D:D:D
  • skatina sii ku dinsa
  • Lenna iar in rosu imbracati:D
  • guest_90 bravo!!!!
  • Cyoaparteala ce mai da din picioarele eie strimbw
  • Tate Ce-i cu that moves like Jagger??
  • eu cintecul e bunisor dar nu tipajul e ei nare voce
  • guest_158 dezamagit de tot =/
  • Pavel Turcu ce rochie....
  • nata e bunisor cintecelul
  • andrei pe krakanata mai bine zis
  • Sandu Lor oare nu le este rusine sa iasa pe scena cu asa prestatie? Pana la ce nivel poate sa ajunga prostia...
  • j toti sunt buni si canta bine dar.. deocamdate de euro... nici de $
  • D. si iar fail vestimentar...goosh
  • sherlock haha,eu am purtat rokia aia la prezentare colectiilor autohtone
  • porecle am sa incerc eurovisiontv ca aici nu mrge , blin
  • guest_40 normal.
  • eu_eu ori la ei sunetu e galimyi, ori toti parca s calishi azi, Alecu poate mai bine, si Nicoleta tot, da aici parca s impuscati in gat :(((
  • viktor ma asteptam la ceva mai mult
  • Miha are ceva asemeneri cu piesa Sattelite de Lena ..
  • any sini bl o imbarkato asha
  • svetik asa moldovenii in rosu sau negru
  • guest_122 credeti-ma idiot--dar imi place
  • kkkk muligambiaaaa,unde eshti????
  • Shmekerul a aaa a muzonul rupe :D
  • alina asta ceva i se nazare
  • haha: nare aer diamu
  • Serii e buna prestatia , dar la eurovision nu prea o sa faca treaba
  • white una dintre putinii buni din MD
  • !! o stricat-o pe fata...e asa de frunoasa in realitate... stilistul e groaznic ..!!!
  • olika binisor...dar tot nui ajunge parca ceva
  • cuc asa de fapt suna live, de obice ii fanera
  • Cristinuta asta cine-i?
  • DeMedia gata, la anu particip si eu :D
  • guest_168 votati piesa, e unica care poate sa ne claseze pe un loc bun
  • guest_130 неплохо
  • guest_63 saliut
  • hhgj da sunetu inecat
  • Nicu alexandru manciu, adrian ursu, cristina croitor, acord iata cine merita eurovision
  • irina ce alt sait pe care sa mearga ok mai stiti????
  • limon cinta binisor
  • ZZZ voce ok.. dar .. vestimentatia si show-ul unde e
  • bo Exact, are ceva cu Lena:)
  • Radu de ce n-am participat şi eu la eurovision? :( se pare că nu avea să pierd nimic
  • solnishko Park li`o kalkat pi tati pe ureki sh git pe toti azi....:D Serios...ori cv ne`to ku sunetu`...ori nushtiu ....[adika shtiu ori tatsi nau voce :D:D:D:D:D
  • misterds saliut lume
  • guest_155 stilistii din moldovace fac blya pidari
  • t. ce e costumatia? cinta binisor...dar hainele lasa de dorit, desi acesta este un factor important
  • guest_98 :d .
  • cena copii de bani gata nu inseamna ca is cei mai buni
  • buburuza mai bine trimitem un taraf cu tigani, mai multe sanse
  • BUNNY lol
  • Fuck this shit!! da scena rupe parka borta...
  • guest_32 Doamne ce forteaza vocea
  • eu kaketa derganaya
  • Shmekerul da merge la chintec in comparatie cu altii
  • sweety tipa aiurea
  • pavel bunisor
  • sa ma kak ma duk la viceu
  • guest_158 vocea sucks , nu se simte in pielea ei ...
  • guest_122 chiar imi place
  • Alex rage tare, parc-o *ute cineva)
  • svetik buna
  • f_89 da engleza seamana a engleza ...in comparatie cu altii
  • stells eurvizion lume multa, lume buna eurivizion, pavel turcu
  • ahaha doamneeeeee
  • bo Chiar e interpretare identica si "prezenta scenica" copy paste
  • zozea oribil
  • ION lena satelite copy paste
  • Rrrr :d
  • guest_203 ujas , nu am cuvinte:((
  • Cristina) si cu figurile iestea?
  • alina saliut quist98
  • nico accentul il are in comun
  • nata e buna piesa asta,hai nu mai criticati si voi atita
  • euuu nu va stresati o sa castige Suedia anul acesta
  • solnishko Am impresii ca si eu pot deja pleaka la eurovision....poate voi kinta mai bn :D:D:D:D:D
  • Marcellus Un alt site de pe care sa mearga mai bine stie careva?
  • El Pokynhauser shine scrie dupa mine-i pidar
  • ahaha ooooooooo
  • white bravo Nicoleta!
  • BUNNY alta oaie
  • Rrrr opa iaka si Getuta
  • Natachyka oooooooooooooooo
  • tu m-ă știi fuuu fuuu uu fuuu uuu
  • winnie the pooh nuuuuuuuuuuuuuuuu
  • ion shi burlaku
  • Shmekerul pffffffffff numai asta no ajuns aici
  • cuc Pasha Parfenii deocamdata ii cel mai bun...
  • Sky ooo..jeta
  • f_89 oooooooo cum fara asta
  • solnishko Amu`ii Geta :D:D:D:D....Iaka asta`i de ris amush :D
  • svetik iaka si ai nostri
  • misterds doamne feereste ce interpreti
  • nietzsche sunetu nu prea ori emotziile prea mari )) imi pare rau,dar cred ca doar cristina a aratat "voce shi show"...ceva ,ceva este ))
  • Nicu offff si asta ne dat de ras la eurovision in serbia
  • fanatik cum credeti cine din partincipanti merita sa prezinte tara???
  • BUNNY dar de ce suedia
  • miku nuuuuuuuuuuu
  • eu ooo
  • Natachyka Gettaaaaaaaaaaaaa
  • j o iata Getaa va face treaba - ca doar se lauda ca nu a citit nicio carte!
  • Serii ooooooooffff iaca si pozoru nostru din 2008
  • pupsic fuuuuuuuu, iar jeta??
  • Eugeniu Of, iarasi getutza, mi-i greata
  • misterds xfh
  • olika offfffffffffffffffffff doamne da pe asta de unde au scoso.....
  • dfg aya ayayayeeeee :))))))
  • tina so vedem pe Geta
  • any yak alta mai buna,ajunge odata cit o strikat eurovisionul
  • Marcellus Un alt site de pe care sa mearga mai bine stie careva?
  • pupsic fuu , iar jeta??
  • viktor amus ne ridem
  • guest_40 pe trm nu merge deloc.. so.. depinde de viteza la internet ;)
  • guest_230 unica sansa pentru noi e s trimitem 5 mosnegi, macar o sa le fu'a pe babele din russia :))
  • guest_155 oo geta bravo!
  • ich da' prezentatorii cine ia selectat?
  • guest_10 kiki miki
  • buburuza ooooo wolkswagen Geta
  • cena fuuuuuuuuuuuuuuuuuuuuuu
  • adelush iaka vine si doamna mirtzoaga..off mai multa invidie nam mai vz la nimeni ca la fimeia asta
  • Dragon Nu mai nu asta :(( Geta, du-te acasă
  • guest_104 fuuu, n'am ochi s'o vad pe asta. n'are ce cauta la eurovision. Geta sucks
  • t. unde s-a pornit iar?)))
  • Miha unde ii divanu ? :D
  • ZZZ 3 min inchidem sunetul :))
  • Fuck this shit!! seva normal
  • Spectator Striptiiiiiisul!!!!! Stripteusa!!!!!!
  • kalin next
  • cuc geta lasa sa cante pentru melodramatici in cluburi de jazz...s-a facut odata de ras la eurovision
  • Spectator http://apropomagazin.md/2012/01/24/geta-burlacu-dezgolita-frumos-foto-incendiar/
  • viktor ce prichid are sexi
  • f_89 opaaa
  • pupsic oh my god:)))))))))
  • eurovision iaca na nu am stiut ca si geta iar vrea sa ne faca de ris
  • Eugeniu oi blin...
  • pingus șii di bunăăăăăăăăăăăă
  • svetik negru si rosu azi e la putere
  • sashabognibov nu-mi place de geta
  • misterds saliut
  • sds vaca asta vai de curu ei
  • guest_10 trrrrrr nazat
  • sweety ce asta e cintec? iar de adormit
  • maria doamne vocea ei enervantaaaa fuuuuuuu
  • pp Geta a mai fost si nu s-a descurcat, Nicoleta Gavrilita tre sa mai lucreze oleaca si e mai mult decat bine
  • Olga fuuuuu dute dracului
  • 111 e altsheva poate s kinte?
  • solnishko Pptz....ni`i rushine ka`s moldoveanka :D:D:D:D ku ashe "elita"........:D:D:D:D:D
  • Spectator Miha, ahhahaha +1))))))))
  • guest_130 кабаре!
  • Tate Inca un look in "voga"
  • kalin777 next
  • cretzulea unde ii ursu ?
  • guest_122 230 chiar am ris cu lacrimi
  • buburuza am sa am comaruri noaptea )))
  • sa ma kak boooooring
  • grisa o baba intre copiii ei
  • Topo fiuuuuuuuuuuuuuuuuu
  • Marka iaca si asta
  • limon si schimbat imaginea..
  • olguta27 dela divan a trecut la taburet4i!:)
  • Vero Gheta Burlaciu
  • t. viktor+
  • grisha fuuuuuuuuuuuuuuuuuuuuuuu
  • RED pt cabare mai tre shi silueta sa ai
  • pupsic cantec de eurovision.. mda
  • Curcubeu vozomnila sebe marlin manroe
  • eu... asta poate cinta)*
  • alina ma asteptam ceva mai mult de la geta
  • Alex și cu kkt ista pe scenă?
  • iuh ce frumossssssssssssssss
  • BUNNY lu cui ii place cintecul suediei?
  • tina cintec mort...despre nimic
  • pupsic eu cred ca moldova trebuie sa stea acasa. nu sa ne pozorim la baku
  • Lilia mare prikid.... macar daca ar avea corpul potrivit pentru asa prikid... dar asa...
  • Curcubeu kakatzei de capra
  • cena Faraon
  • y omg
  • cristina are kopkii akasa si ii arde de streptease :)
  • f_89 :D:D:D taceti ca o mai slabit oliaca
  • Administrator: Shii ku rahatu ista?
  • solnishko La dinsa mebeliu`:D....se reduce de la piesa la piesa :D
  • euuu ellytza RT @siuilruin: #eurovision Moldovian final is like freak show!
  • Boss Cinte credeti ca cistiga astazi ?
  • solnishko de la divan la tabureto4ki :D
  • zayka o mai fost odata la eurovision si acuma iar
  • cineva.. nare ce face...daca atsa cinta bine eu cint mai bine ca rihana
  • eu da treb de stat acasa
  • j numai sa ni fi cumparat anul asta pe cineva nu imi place "forta cantecului" din vocea ei
  • 111 keltuim bani dijeaba!!!!!
  • guest_40 da tu ai vazut cintecu Romaniei? :D
  • kaziol booooring
  • guest_122 pozor
  • Nicu nu ma impresioneaza sudia
  • Shmekerul cu e numele interpretei a lui suedia? ca vreau sal ascult
  • arji pote se crede ca e la moulin Rouge :-)))
  • Strangleeer wow, si-a schimbat si stilul vestimentar, si cel muzical...
  • anjela offfffffff geta, dute mami acasa
  • buburuza luatio cineva de pe scena, imi sperie copii
  • kristy jazz-ul e frumos nu si in interpretarea ei:D
  • :D Lina asta de burlacu iar .................
  • viktor Alex chiar mare kkat
  • any off,de-ar scapa-o macar odata aistea))
  • Spectator poporul
  • guest nu, deloc nu merge, Geta- acasa te asteapta cei dragi!
  • guest_230 iar Geta incearca sa faca din arta jazului cacat comercial pt eurovizon
  • Tate Tipa a slabit si cred ca poate merge la Eurovision. Sau ce?
  • Tatiana ce de naivi mai sunteți
  • euuu Loreen - Euphoria
  • cena ar trebui sa castige Transbalkanika
  • dumitrita geta asta ii strashnika!!!! lucreaza cu gorgos de asta ii antipatica shi cacacioasa
  • eurovision geta potoleste-te dute acasa nu ai sanse
  • grigore asa de national
  • eu o fost odata ii ajunge nici no trecut in finala
  • Nicu Romania are cantec de nota 10
  • Spectator Romania....mai bine catalin castiga...nu pre aatrage cantecul ala...
  • kaziol jitzika
  • xodibox stai
  • Herokiller asa de frumos cind ca vreu sa incid volumul ))
  • Petru divizia de tankuri )))
  • pupsica imi plac piciorusele lu jeta
  • M pricisonu nu-i merge
  • Alex tare ruptă din soare..
  • kalin777 nu inteleg kum o ajuns in final ...
  • BESHINA fuuuu puteeee pe aiciii
  • bleaaa cat nu s-ar starui ee, nu-mi place shi gata
  • :) geta fuuu
  • cuc n-o mai slabit deloc, vai de capu ei
  • anjela scriti un mesaj la orange sa se linisteasca
  • ion suedia: loreen - euphoria
  • guest_122 oare cu ce am gresit
  • Shmekerul da iak a lui suedia e misto piesa
  • om iaka de ce a slabit Jeta :) ar fi trebuit 3 dansatori so duca :)))
  • alina eu
  • guest_32 Romania a re cantec ritmat , dar ieftin, adica numai comercial
  • f_89 slava domnului
  • guest ciao Geta!
  • Nicu din pacate Catalin nu a castiga
  • eu o ora de reclama
  • guest_40 Romania se duce cu un rahat la eurovision.. nu cintec..
  • kira dar pasha parfeni a fost deja?
  • solnishko dc nu...piesa romanilor imi place....(L)
  • kalin777 o reklama
  • rex shirahaaaaaat
  • Nicu Sigur ca cantecul lui era cel mai bun
  • guest_205 zik anu trecut mai bine o fost organizat tot si participanti ca anu ista !!! si conducerea ca o cheltuit multi bani da pe ce ? mai mult ca in buzunarile lora o ajuns bani
  • RED da ii faina loreen numai ka mie mai tare imi place ciprul
  • svetik reklama
  • anjela haideti sa bem o piva cai reclama
  • svetik relaxare
  • guest da, Pasha a fost nr. 3
  • irina mai ziceti-mi va rog un site normal...????
  • Administrator: Loreen - Euphoria Concurent nu rau
  • limon dar cine cinta la romani..spuneti va rog??partcipantul..
  • RED pesa lA la Love
  • olguta27 mandinga la romani
  • guest_32 http://www.eurovision.tv/esctv/main?program=48443
  • j sunt de acord cu -cena- "ar trebui sa castige Transbalkanika" macar nu o sa-mi fie rusine sa zic ca sunt din Moldova
  • ich si publicitatea e in limba concurentilor...fuuu ce rahat
  • Nde nici nu stiu care e mai bun :D
  • guest_155 franta cred ca va berui la eurovision
  • trololosh arko!
  • wizzzzzyy la romani e mandinga
  • guest Mandinga la romani
  • guest_122 cine o fost pina la Jt?e super
  • Serii haideti bai nu faceti reclame la alte tari
  • cristina la romini mandinga se duce
  • Nicu mandinga
  • DoDo SunStroke cu Tira au cintat sau inca nu?
  • cocco mandinga va reprezenta RO
  • :D Mandinga - Zaleilah(ramania)
  • kira TransBalkanika a fost?
  • Nica Romania: Mandinga Zaleilah
  • Spectator duru! :d
  • :D Mandinga - Zaleilah
  • Serii de acort , numai Transbalkanika
  • kira Tira nu mai e demult in ESC!
  • solnishko piesa romanilor e bunishoara (L)....imi place :P
  • limon Multumesc Olguta27
  • BUNNY haii sueeeediaaa
  • guest DoDo SunStroke nu participa la finala
  • Cristinuta cati au cantat deja?
  • guest_122 da o fost transbalcanica?
  • BUNNY gooo sweden
  • alanis pasha e cel mai bun
  • anjela asta cu molpedu se duce la eurovision))
  • eu Loreen - Euphoria
  • olguta27 9 interpreti park
  • pupsica spuneti-mi pls cine au cantat N.1 si N.2
  • Spectator lasa sa se duca))))
  • WTF Pasha Parfeny cit de cit merita .....
  • alanis cred ca merita sustinut
  • solnishko Mmm...piesa Suedezilor e buna :D(L)
  • BESHINA duru duru spala ghini curuuuuuu ihaaaa
  • arji eu sper si chear vreau sa cistige Transbalkanika
  • j pasha e bun, da prosteala cu fetele.. si nu trage pina la Transbalcanika.
  • Bloodvik ce merge Eurovision ?
  • olguta27 limon, cu placere, vad ca multi ti-au raspuns
  • svetik eu tot pentru pasha imi dau votul
  • alina mai multa reclama decit muzica,mai bine prezentau o reclama despre rerzervative cu balzam si solutie albastra
  • Bloodvik ce merge demaa /
  • limon ce super e piesa la Romania
  • Alex paralela 47!
  • DeMedia ba oamenilor, voi nu apreciati adevaratele talente, eu cred ca Dara merita sa mearga la Eurovision
  • BESHINA pasha nu a facut fata
  • BESHINA kiar a kintat rau
  • Bloodvik Baieti merge Eurovision ?
  • kira hade, ba! ca m-am saturat de publicitate!
  • solnishko piesa Ciprului e buna :D(L)
  • Milania numai paralela!!!!
  • viktor and 12 points goes to pavel turcu
  • solnishko ivi adamou - la la love
  • 11 offff zacalibali cu aist pasha, nu-ni mai place deloc
  • Shmekerul da piesa suediei ma lasat fara cuvinte
  • dafaq..?! slabe sanse pentru RM la marea finala... oricine nu ar accede acolo. Trist.
  • Shmekerul eee coool
  • DeMedia Transbalcanika are o piesa buna, dar a 2-a vocalista parca cinta manele
  • winnie the pooh vreau ciocolatăăăă!!! :D:D:D
  • limon Merci Olguta27..da am observat si eu..merci tuturor de raspuns
  • guest_32 mai , daca nu avem cine sa merga de ce se mai cheltuie bani in zadar
  • alanis pasha shtie sa se prezinte cat de cat pe scena si live poate canta bine..bafta multa pashka
  • cena nu va irositi banii cu altii, votati pentru Transbalcanica - Balkan Riders, ei au sanse reale
  • Cleo bai cand canta Croitoru?
  • tu m-ă știi da la prezervative nu face publicitate
  • buburuza da, suedia, e tare buna, recunosc
  • WTF Dara frumos cintec
  • Milania ardeeeee!!!!
  • guest_205 Dara + 1
  • solnishko Croitoru`deam o cintat :D
  • irina transbalkanika e foarte urit sper sa nu cistige ca iar ne dam de rusine
  • kira cleo, croitoru a cintat!
  • kit slabuts
  • Spectator cumparati telefon Facebook!!! :D
  • j paralel-lei 47 e "paralel" la ce concurs sa mearga, important a fost lume sa -i vada, cred ca asta au cautat
  • guest_191 Deja a canta
  • FluBBeR cum se voteaza? de pe telefon mobil?
  • Tatiana Cleo Croitorul deja a cântat !
  • leska cit costa ca sa suni sa dai un vot?
  • cristina eu sunt de acord cu cena ptr transbalkanika
  • Sss Dara !!!
  • Spectator aistea nu pot scapa de concurs :D
  • haha pasha s-o ofilit..
  • Cleo eiiii blin..si cum a cantata? v'a placut?
  • guest_59 BESHINA, stai acolo in fund, că pân la cap cu URECHI şi auz, mai ai mult!!
  • kira ce is bilbiiti prezentatorii!
  • WTF 8 lei )))
  • nata transbalkanika fuuuuuuuuuu
  • cena Transbalcanica - Balkan Riders
  • winnie the pooh cam des se bîlbîie ”minunatul” prezentator cu ochelari...
  • eu transbalkanika e aiureade tot ((((( doua mitse
  • kira tolea, nu te caca de sus!
  • guest_122 safost comii la putere era redroom
  • Spectator mariana shmandrila
  • stimm pașa nimic nou nu a arătat, așa că lasă-l să steie acasă
  • schatzilidia narooook lida
  • viktor intreabo cum e sa primiasca cu microfonu in bot?
  • mikutza DeMedia ...ai perfecta dreptate...Dara bafta si succes...
  • dafaq..?! Prezentatorii sunt total patetici. Mi-e rusine!!!
  • guest_100 facebook e mort...la dinsu cum lucreaza?
  • tu m-ă știi cana da
  • BUNNY moldova o sa cistige cind cleopatra stratan o sa se duca la eurovision
  • WTF Dara Open your eyes "soooper"
  • Cleo Mariana dute fata hai de unde ai venit! fuu
  • MB ce tsaranka e mihaila asta )))
  • eu http://www.tvr.ro/eurovisionromania/selectia-nationala/mandinga-va-reprezenta-romania-la-baku/
  • guest_205 da taranka mare
  • MLK mihaila du-te acasa
  • mikutza Dara super piesa..ai votul meu..
  • cena Transbalcanica - Balkan Riders
  • guest_40 de fapt eu am cintat titanic :DDDDDDDd
  • guest_155 ai memorat piesa/ nu defapt am cintat titanic
  • josanu Pasha Parfenie e cel mai bun
  • guest_155 :ddd
  • Spectator papanaga)
  • one Dara Open your eyes
  • Cristinuta astia habar nu au de muzica?
  • Miha crezi tu ...
  • dafaq..?! mihaila tsaranca..
  • lol vreau sa zik ca ma simt ok ...who cares >???
  • stimm patlagica
  • buburuza )))))+ daca erau sa fie comunistii, era sa fie red room ++++
  • lokryd da da buna interpretare
  • solnishko Strashnik....ce`i ku parul lui mihaila?:D//// E aiurea tot :d...shi kiar "Valurile marii zbuciumate " :D
  • live Foarte slab eurovision mai ales Mihaila
  • Topo mihaila, acasaaaa
  • milaia999 Dara e cea mai buna :P
  • Bloodvik eii baieti nu avem sanse in Europa baieti !!!!!
  • alanis josanu, sunt de acord cu tine...Pasha e the best :P
  • cena Alte piese normale nu am mai vazut
  • Cristinuta Unul interpreteaza aiurea o melodie, alta crede ca-i a ei(asa de bine o stie)
  • zl ce proasta e
  • sweety mie imi place piesa Inayei
  • kit hahaha...mariana mihaila...mmmm slab!!!
  • dafaq..?! Mihaila Tsaranca. True story.
  • Fun Ursu cind cinta?
  • kira melnic, tu aisi nu esti la nunta, fii serios tovarase!
  • Жаль, что Нелли Чобану нет... олег
  • kkkkkkk ce-i cu paru ei....
  • wizzzzzyy hahahahaha -ai memorat melodia?? -de fapt cintam titanic hahahahahahaah :D:D:D:D bravo baiatului
  • schatzilidia buna seara seara seara
  • Spectator astia nus destul de antrenati?)) si au luat kkt de tricouri?)
  • Natachyka Ursu 13
  • anjela mihaila parca ii din anii 70 cu coafura ei
  • dafaq..?! Ursu e o comedie. E penibil!
  • solnishko Pozor RM anu`ista nu`i erovision dar naiba shtie`ce :D
  • josanu mda interesant cine oare va cistiga
  • milaia999 dara!!!! ))))
  • stimm injecții mortale în cap le trebuie
  • guest_79 :p
  • eu toti cu flaiere in miina...robot
  • RED injecti?:D
  • .... :p
  • guest_29 mie imi place prezentatorul din green room..e mai dezghetat un pik ca ceilalti
  • kit tzarani!!!
  • Cleo asa de greu merge transmisia!!!!
  • WTF нелли чобану sa retras...)))
  • irina daaaaa
  • milaia999 doamne,stimm....ce prostii
  • me cum a cintat Nicoleta Gavrilita>????
  • guest_40 DARA, vreau sa vad prestatia!
  • voronin trimitetil pe bolocan cu piesa NOSA
  • j asa poate trebuia sa cante ca sa treca
  • guest_122 padruga pina la jeta a fost buna
  • cena Transbalcanica - Balkan Riders credca vor fi winners 2012
  • lily da,cred ca parfeni totusi,daca are cineva sa plece...adica piesa lui parfeni e pt ev,nu el,ca el nu are de fapt voce...restul e rahat
  • solnishko :d Wahahahahaha.....shi`i ku rep`u Ista ? :D
  • buburuza nu sperieti copiii !!! imi plang copiii !!!
  • Cristinuta n-au ce face astia?
  • MB show nostru e ca din anii 90...lipsa se inspiratie,foarte sarac totul,totul lasa de dorit
  • sasa7777 super
  • arji asai de delicat juriul de a ales asa cintareti
  • kit mi-e rusineeeeeeee ca ne vede europa in acest moment!!!
  • milaia999 ei ds....prezentatorul din green room asa glume proaste mai are :(
  • Spectator nr 10 = locul 20
  • MIHAILA FOARTE PRIKOLINA mihaila foarte prikolina
  • kira papa,papa :)
  • kira papa,papa :)
  • Fun multumesc Natashika
  • Spectator papa daca nu ai ce papa acasa, la cat de slaba esti))))))))
  • guest_122 merge bine transmisia
  • Natachyka a flămînzit săraca
  • sandu fashik : dak nu vreti sa stingem apa rece votati numarul 10
  • FluBBeR unde pot vota online ???
  • Cristinuta :)))) lol
  • solnishko Kredka prezenta mea a fost destul a in scena :D
  • M stilistii trebu arsi pe rug
  • guest_50 privet la toti!
  • solnishko no`o :d
  • sasa7777 si pe scena ruguma
  • guest_215 вщьфту аукуыеу
  • eu totul lasa de dorit...asta nu nu mai in muzica
  • Puff Doamne, pot fi şi ele ceva mai naturale???????? De ce atît de mult machiaj şi ţinute "delicate" dacă yic piesele lor sunt foarte bune şi au un show la care "au lucrat foarte mult" ???????
  • J Lo Gavrilita dute si invata sa vorbesti
  • MB shii cu gavrilita asta????? din ce sat a venit ? parca e de la stina!!!!!
  • RED transmisia greu ft greu
  • anjala gonta tat normal
  • OM noroc :))
  • Milania privet
  • Natachyka Fun Cu plăcere
  • kate_89 domane fereste)))))))))))))))
  • svetik guest_50 salut
  • WTF teeeeeeeerpil a buuuurrrlacu
  • Tanny Pasha Parfenii a cintat?
  • limon oo geta..ia sa vedem ce zice
  • solnishko :D:D:D:DGEta shi divau` din urma :D....a am uitat sh`o lenta`n kap :D:D:D:D:D
  • guest_50 Cat costa un sms?
  • stimm geta-a trecut timpul tău... demuuuuuult
  • rex in prima data am incercat )))
  • J Lo taranism
  • Milania buna seara....tsoook!
  • cena Da cine-i homosexualul cela?
  • Dimulica ii pizdets cu noi la eurovision
  • buburuza Plahotniuk, va cumpara azerbadjanul, si vom castiga Eurovisionul!!
  • 111 mihaila dute sh kinta in piata gentrala,acolo a s shii votata sh nu numai.. ai s fii intrun ocean nelinistit kiar!!
  • live baba ge
  • Cristinuta mai pe scurt... show-ul asta e o comedie
  • patnurush la 18 ani ai ei nicoleta a făcut mai mult decît tu în ai tăi 35 de ani zadrot concenîi ce eşti
  • Suruceanu of getuto, ascundetio, ascundetio
  • RED povestea o fost pt geta
  • J Lo Ar fi bine sa mai fie si inteligenti printre ei , ca sunt putini de tot
  • alex mi-i rusine...sicer... ar trbui prezantatorii de la jurnal tv sa prezinte....nu prostii astia
  • Topo un sfat Geta, nu mai dansa...amina apocalispa
  • guest_114 buburuza :) lol :)))
  • ANDREY SI ANGELIKA votati mihaila caci ea merita intradevar
  • nicu strasnic geta!!!
  • eurovision nâââuummmîîîruu.. dzîshi pliakî de aishii nimeniii nu te voteazîîîî
  • anjela sii taieta limba lui geta,nici sa vb nu stie
  • solnishko mami ii obosita :D
  • WTF terpila burlacu
  • Tanny pasha parfenii a cintat deja?
  • guest_122 buburuza si pe urma?:))
  • Poreclaa cat costa un sms>
  • Mary cristina esti bravo! te sustinem cu totii!!!
  • eu mai bine plecaii la distractii si nu faceai vint pe aici
  • live baba Geta mai bine renunta ca fani nu prea mai are
  • RED Prosta
  • solnishko :d:d:d:daaaaaaaaa....votati geta burlaku :d:d:d:d:d wahahahahaha :d
  • sandu aaaa,votati geta burlaku neaparat si voshi mai are
  • j nu glumiti pe tema Plahotniuc Azerbaijanul area mult petro ca sa se compare sumele
  • J Lo behaism
  • rex aaaaaaaaaaaaaa votati geta neaparat =))))))))))))
  • guest_145 nu votati betivanca asta de geta
  • buburuza t.a.r.a.n.i.
  • ahaha getaaaaaaaaaa looooooooooool
  • arji tare greu mai merge transmisia , poate mai este vreun sayt ?
  • Suruceanu Geta e nebuna, ea dupa accidentul ei sa lovit la cap
  • Natasha` dute fee Geto shi te kulka..
  • dafaq..?! Geta... ascunde-te te rog. O data ai dat MD de rusine. ajunge.
  • Spectator asta a invatat una doua note si se creze buricu pamantului?)
  • Funny numai din mina poate da :D
  • stimm și loh îi prezentatoru
  • j mai canta astea azi ceva?
  • guest_64 dv
  • Natachyka offfffffff, mare-i grădina ta, doamne
  • dfbd dfbd
  • me Voi pentru cine votati???
  • eu transmisia e ok daca ai viteza
  • ZZZ nu votati jeta... ca va fura chiuveta
  • live jos Geta
  • alinnuta333 da 100
  • WTF dafaq..?!-de acord cu tine
  • lokryd sau pozorit pe o tara intreaga
  • Marin cum zice un prieten de'al meu: aşa m'am za*bit de proşti :D
  • Dumitru Salut
  • RED in skimb blonda e buna
  • eu oooooooooooooooooooooooooooooo
  • solnishko oooo,,,,,ursu vini :d:d:d:d:d
  • cena Transbalcanica - Balkan Riders the best
  • kalin777 aaaaaaaaaaaaaa
  • 111 opaaaaaaaaa
  • Cristinuta zicala populara cu Baku :)))))))))))
  • Spectator adriancik )))) lohancik
  • anjela hopa ce poetii prezentatori
  • ANDREY SI ANGELIKA mihaila
  • Olga iaka si ursulika
  • Poreclaa oooooooooo andrusha ursu. iar fuuuuuuuuuu
  • concurentul nr 13 nu ma votati
  • Kristina mqi,da-s prosti de rag prezentatorii astia
  • lol daisy duck ...
  • 111 la ciokanaaa
  • alinnuta333 o Adrian
  • morgana mie imi place tare prezentatorul! e un barbat destept! Iaka prezentatoarea e levaya)))
  • lily ursu e ujas,desigur...
  • Natachyka Asta voia sa seduca
  • MANGO omg paziti-va iese ursu din birlog
  • limon opaa Adrian cinta nu prea bine
  • guest_205 iaca si ursu sa vedem
  • dfg ce o zis ăla?... fii laba(cum) ????
  • Funny ian sa vedem ce poate face andrian live ?
  • WTF Haai Adriane fa cv Show
  • ZZZ adrian etno ursu... asta nu e de eurovision, e pt cumatrii :))
  • Dumitru Salut
  • Engelhart ursu. ursuu!!
  • concurentul nr 13 eu's doghitok
  • Nica de ce n-or zice si ei camera verde in loc de grinrum?!
  • sasa7777 da nr 13 va pleca la bacu eu va garantez
  • omg Adrian haters incoming
  • oleska cit costa un vot?
  • guest_122 si mutra de bikalan
  • 777 adrian unde te bagi ))))
  • Suruceanu Stiti care e cel mai nasol lucru, ca mama prostilor mereu e insarcinata
  • rex ursu ar trebui sa incerce sa cante fara tampon
  • Natachyka Da Ursu - parcă rage o capră la refren
  • eu ursu e ok...e bun dar nu pentru eurovision
  • anjela oooooo eeeee,fuu parca e ooaie care nu o minkat de o luna si vra minkare
  • guest_122 aista la mutra parca-i resetnicov:))
  • irina adrian fuuuuu
  • solnishko Pptz:DUrsu : Eu shtiu ce am de fakut in scena :D:D:D:D:D
  • dafaq..?! uitati-va ce-i de jalnik A.Ursu... come on... care fani?!!?! Cine-s fanii lui?!!?? Vreau sa-i vad si eu!!! De o viata traiesc in tara asta si nu am cunoscut nici un om care sa se declare fan A. Ursu!
  • Poreclaa concurentu nr.13 hahahah:))))))
  • rhgdfsa ursu nui-mi place
  • arji sede ursu in camara unde este ursu
  • 111 tzaranu mamii tsaran a s ramaii
  • cena Ursu, shet!
  • kira Ia la dinsu...doamne
  • WTF 8
  • Suruceanu oleska, un vot costa o portocala la Ursu
  • stimm ursu-n butcă
  • adelush ati inteles baieti. votati ca el stie ce are de facut in scena.. mai parkai o muiere.... :D:D:D MUIEEEE
  • tatsu lui pavlusha turku way ian gura blyea
  • lily doamne,ce engleza!!!!
  • guest_159 koperfield !
  • 777 ndaaaa
  • aaaaaaaaaaaaaaaaaaaaaa shi wey cu acvariumu ista? ))))
  • RED cineva o zis de capra nu numai la refren da shi de la incepoot
  • Marin cel putin cinta destul de bine live
  • xodibox ursu in *kletka*
  • brăduţul cât de patetic
  • Serii capie de la Eric Saade cu stecla
  • sasa7777 macar tu adriane nu ne da de pozor
  • 111 el nu poate dansaa
  • buburuza doamneeeeeee
  • Funny doamne ce nebum a aparut in scena
  • Poreclaa ursulika ii in cushca
  • lol.:) kletka
  • Topo s*cksssss
  • lokryd ursu şăzzz ăiii
  • miorita Aista-i Pavel Turcu
  • alinnuta333 ...............
  • Tate Aiurea cu Eurovisionul acesta.
  • Spectator are sanse de la juriu :-s si plus aresanse k are blat cu multi k a prezentat emisiunea aia pentru copii.....
  • kira O sa te inadusi Ursule in cutia aia!
  • liubo4ka kaseshde dupa Bilan?
  • voronin ial de p... si dal afra
  • J Lo Bine cal tin in kushka
  • oleska cit costa un vot oameni?
  • ngelish pontu din bicicleta pe scena?
  • Funny numai avioane nu ajunge aici si restul tot este :D
  • kuku el în cușcă stă))
  • patnurush shi ai 7 fetze uăi ?
  • anjela io mai ramas citeva euroi de la nunta si so facut spectacol cu cabina...hahahaha
  • solnishko :d:d:d:d:d hai sh`om raji :d:d:d:d:d
  • nevermind shoooooooooot him!!
  • WTF IN ce pl sta el acolo
  • cena big sheet!
  • stimm ursu pe bicicletă)))
  • josanu ursulika si birlogul lui ddddd
  • tatsu lui pavlusha turku datzii fok
  • guest_122 mine ies in piata si strig jos eurovision moldova
  • Spectator Voronin!!!
  • lol iesi din butca seea , ca vrem sa vedem miscari
  • Serii si totusi astept Trasnbalkanika
  • kkkkkkk ursu duti sh raji in paduri
  • liubo4ka nu este contagioasa piesa...
  • Cenzura Bai, stringe bani de la Italia ca showul tau e rau de tot.
  • MANGO cine l-a mintit asa rau ca poate cinta?
  • Spectator era mai interesant daca se umpleac cu apa...
  • buburuza il gazeaza fascisti !!!!!!!!!!!!
  • j cine stie al catalea e ursu?
  • mindfucker shii cu fumu ala? e toxic?? da doamne
  • dfg lo pus pe voronin la tobe :))))
  • brăduţul straşnic.
  • 111 kinteku ista mai seamana ku unu,da nush ku kare precis
  • sasa7777 in strada cind ai filmat era mai super decit pe scena
  • Marka eu nu inteleg nah sa canti in engleza da nu poti, cantati wey in romana, oi blea si show
  • alina vocea lui e ok parca dar cintecu e de kikta, e de cel de cintat la cumatri si la nunti :D
  • eu_eu doamne fereste!
  • lily are adenoizi,trb sa se opereze m intai..inghite cuvintele...
  • Miha dispare ursu :D :D
  • guest_140 show de 2 bani ..... mii greata
  • mujiku niku tu esty nevermind?
  • eu sii cu aburii on cusca????
  • mar se inadusha de la fum >D
  • guest_20 Parfeni o sa se duca la baku, primul loc o sa-l ia Sweden Loreen Euphoria, al 2 sau al 3 Russia cu babele....
  • solnishko Iak el amush a sa`nadushe akolo :D:D:D:D:D:D Sk...Bl...Pozor :D:D
  • ADina piesa nu e pentru eurovizion ursu
  • kalin777 el se kinue sa iasa dar nu poate, dramatik.
  • 111 be yourself sh kataite pi bicicleta:D
  • guest_159 showu rupe))))))))))))))))0
  • f_89 cei cu circuuu istaaa?
  • WTF iese
  • ZZZ I suspect that I may not be drunk enough to fully appreciate Moldova's #eurovision selection :))
  • limon eii show-ul e cit de cit bunishor...dar e plagiat un pik de la suedia de anul trecut ERIC SAADe
  • Poreclaa voi intzelejeyi mesaju cantecului?? shi-i cu cushka , si-i cu bicikleta????
  • eu mai bine ii tragea o populara ieti mireasa ziua buna
  • lokryd ne kishtiga mai shi rushii
  • guest_213 tic tac...buhneshteeeee)))
  • ANDREY SI ANGELIKA de ce nu merge online??? unde se poate de mai privit
  • eu ii ragusit sarmanu :DD
  • sandu o iak o ieshit
  • lol.:) ka4iok:D
  • Cenzura stringatura de bred pe scena
  • adela urit....nu-mi place de ursu
  • MANGO asta tipa e wow?????
  • brăduţul ei cum fără motive populare :l
  • svetik imi pare rau ca pierd timpul in zadar cu asa concurenti
  • Cristinuta cititi regulamentul 1.6,1.7,1.8
  • Puff o.O... bine ar fi dacă chiar aţi fi voi atunci cînd ieşiţi pe scenă şi nu prefecătoriile astea de interpreţi...
  • Tatiana Poftim la Circ
  • Runy nu vad nimic nou... fireshow? la Eurovision trebuie trimis altcineva...
  • guest_132 asta deamu ii moldovenii au talent
  • stimm circ nașaru
  • Metrun O sa deie duhu acolo
  • aaaaaaaaaaaaaaaaaaaaaa el sta ascuns de bataia cu patlajele =))
  • eu eu is eu
  • Miha parca canta beyonce .. da nu be yourself .. :D
  • Cristinuta si vedeti ca e non sens cum au scris ei
  • lynka ursu coregrafie tre oleaca
  • Natachyka trebuia să-şi pună o cuşmă ţărănească
  • cena degetu mare-n jos p/u Ursul!
  • guest_10 Ursu, esti bun de cintat doar la cumătrii
  • Runy f oribil
  • solnishko Rushine Sk rushine....Asta`i muzika ?
  • sasa7777 asta da muzica nam ce zice macar unu sa mai trezit din toata tumaneala asta cu eurovizionul
  • euuu mai ursule dute acasa k nai nici cele mai minime sanse sa te voteze...
  • 777.... oamenii care intradevar pot canta nus pozorask la as concurs CORUPT
  • sandu beyonce cinta mai frumos,nu intzelegi in muzika ori shi>
  • miha mda, vocea e tare puternica
  • MM show de 2 bani
  • guest_155 pidar
  • Spectator ooooooooooooooo
  • stiopa caca ii ursu asta
  • Cristinuta :)))))))
  • Marin oi blyaaaaaaaa...vine muma :D
  • brăduţul s-a trezit?? sper că glumeşti
  • guest_159 iara asta?!
  • tatsu lui pavlusha turku gara de nord, shiobeni
  • WTF ooo gara de nord
  • Metrun Nacanesta su gatatit
  • mar alta nebuna
  • olguta27 cine stie lista cu urmatorii interpreti care si cu ce numar evolueaza?
  • anjela da astaiiiiii chiar fuuuuuuuuuuuuu
  • xodibox noooooooooo
  • eu 777 total deacord
  • eu amus laja
  • ADina offf Doinitza Gherman , nai ec cauta tu la eurovizion , unde te pornesti :D
  • morgana OMG!!!! Numai nu doinita gherman!!!!
  • kuku încă una.....
  • 111 nu shine la eurovision s dushi ku cintk popular hai s bem ,hai s kintam
  • patnurush sh asta caută anal
  • Runy omg!!!
  • Jeremy may asha tatz leva kint
  • ZZZ Best thing about the Moldovan selection? The clock in the corner.
  • euuu ii piz.... shel mare cu asta
  • madALINA9 super nicoleta gavrilita
  • kuku are șiubotili ei preferate?
  • guest_10 bunica bate toba
  • sandu pleaka akasa nebun-o
  • M_SI 2 Irina Tarasiuc&MC Gootsa “Save a little sunshine” 3 Pasha Parfeny “Lăutar” 4 Alexandru Manciu “If you leave” 5 Paralela 47 “Arde” 6 Ksenya Nikora “You better rush” 7 Leria “A ray of sun” 8 Cristina Croitoru “Flight for love” 9 Mariana Mihăilă “Live on forever” 10 MC Mike & Human Place “Moll girl” 11 Nicoleta Gavrilita “Crazy little thing” 12 Geta Burlacu “Never ever stop” 13 Adrian Ursu „Be yourself” 14 Doiniţa Gherman “Welcome to Moldova” 15 M Studio “Open your eyes” 16 Anna Gulko “Ballad of love” 17 Transbalcanica “Balkan Riders” 18 Dara “Open your eyes” 19 Univox “Moody Numbers” 20 Akord „Live The Show” 21 INAYA “Lights”
  • Metrun Nebuna aaaaaaa
  • miha wtf?
  • tatsu lui pavlusha turku hai la bishi
  • Jeremy yy kred k a s ajung la baku :D
  • solnishko ooofff doamne.....Zaibit poporu` ku ashe muzika.......Spoate sheva normal.....???? shi`i tat hui**** asta?
  • euuu :d
  • Cenzura una si aceeasiiiii
  • brăduţul mai au aceleaşi melodii să le plagieze?
  • M_S_I 2 Irina Tarasiuc&MC Gootsa “Save a little sunshine” 3 Pasha Parfeny “Lăutar” 4 Alexandru Manciu “If you leave” 5 Paralela 47 “Arde” 6 Ksenya Nikora “You better rush” 7 Leria “A ray of sun” 8 Cristina Croitoru “Flight for love” 9 Mariana Mihăilă “Live on forever” 10 MC Mike & Human Place “Moll girl” 11 Nicoleta Gavrilita “Crazy little thing” 12 Geta Burlacu “Never ever stop” 13 Adrian Ursu „Be yourself” 14 Doiniţa Gherman “Welcome to Moldova” 15 M Studio “Open your eyes” 16 Anna Gulko “Ballad of love” 17 Transbalcanica “Balkan Riders” 18 Dara “Open your eyes” 19 Univox “Moody Numbers” 20 Akord „Live The Show” 21 INAYA “Lights”
  • Cristinuta asta-mi place.... macar ma face sa rad, nu ma plictisesc
  • aaaaaaaaaaaaaaaaaaaaaa parodie la zduuuubi!
  • anjela rage,vra minkare mitika
  • stimm kkt
  • iuh da ea o slabit asai????
  • Miha copy paste Zdob si Zdub
  • TZUTZA dibila o ieshit pe schena
  • lol.:) distrabalata
  • lily mare show o mai facut ursu..lui ii pare c dac o facut ghiaghea shela shpagat pe arca ap gata,o cucerit lumea
  • Irina zzz eaxct la ce ma gandeam si eu :)
  • Suruceanu aici chiar pot numai sa rid :))))))
  • guest_29 vesnic cinta etno..obositi toti de ea
  • Spectator shi nai shi fashi?
  • josanu siubotelele fac tot
  • cena Pavel turcu era mai bun
  • Natachyka Offffffffffffff, doamne
  • MM ce nu mai are moldova cintareti normali ???????
  • olguta27 mersi m_s_i
  • guest_20 sora lu Pavlik Turcu
  • Serii Text fara sens , cuvinte aruncate
  • brăduţul care super? măcar engleza să-i fie normală, da aşa..
  • lol ms
  • guest numai nu asta!
  • BUNNY ce pletoasa ee
  • guest_225 nu intzeleg ce are lumea cu ursu,are cynteq shi voce,coregrafia- deja ori face ei ceva cu asta )) shi fara biciclete ))
  • tina doaaaaaaaaaaaaaaaamne fereste)))
  • eu pentru dinsa sa cistinge nu e primoridal
  • j M_S_I multumesc de informatii
  • guest_10 prezentatorii de la evrovijăn rup!
  • Metrun Rap popular
  • Spectator1 Unica piesa care poate sa ne reprezinte frumos la Eurovision e a Nicoletei Gavrilita!
  • oana nu mergeee :(((
  • 111 hai s n ridem :d
  • morgana asta ii catastrofal mai baieti! ea ar trebui sa se mai pieptene uneori, sa mai slabeasca, sa-si revada garderoba, dar cel mai important REPERTORIUL!!!
  • Yo taman e timpu de dus la WC
  • guest_58 stiam ca suntem prosti, da chiar asa...
  • Runy mda... engleza perfecta.... Velcam!
  • dokk astai pu euro!!!!!!!!!!!!!
  • lol.:) :dddddddddddd
  • sasa7777 bravo doinita ca nai uitat de unde esti si cinti despre tara de unde esti
  • Metrun Privet ce faci
  • guest_194 carei textu piesii ?
  • guest_29 nu piesa potrivita pentru Eurovision
  • JustAGuest Shi o mai slabit))) Maladets!)
  • lesy in fiecare an acelas costum, acelas cintec..offf ...ujasss
  • Metrun Privet la toti
  • Spectator morgana, a slabit ,fata de cum era acum 2 ani ...
  • Kira shy pidari
  • solnishko erlcome to moldova bl**....cu ashe muzika m`ai ghin ts`ai astupa fatsa...s nu ti vada nimi
  • brăduţul ce cântece de căcat. mi-i ruşine.
  • ADina dezastru
  • liubo4ka asta e imbinare intre Zdobi si Nelly?
  • Petru tra la la - nu am cuvinte ... hai
  • lol la lai lai lai laa.. omg..cui ii trebuie disperata astaaaaa??????
  • buburuza tzaran0- rocker- emo )))))))))))))))))
  • dsvd parca a cumparat un cantec de la zdubi
  • CRISTINA :d:d:d:d:d
  • marcik shii cu femeia asta in calduri?!?!?
  • guest_10 tățî ratațîi din moldova la evrovijăn
  • morgana Yo drept zici))))
  • 111 da nuu,lasa ea sh asha iaka danseza :D
  • Cristinuta nu e rau
  • ZZZ asta nu canta, dar zbiara!!!
  • anjela hai dute si maninka si nu mai rage ca o vaca...ihaaaaa
  • nevermind o slăbit maitncă :))
  • arthemis imi pare mie... sau a slabit putin doinita? :)
  • guest_3 \hop hop si asa
  • killerkitty mie mi'a plakut Mariana Mihaila
  • cena shit!
  • grappling Cel mai levii eurovision din istaria eurovizionului moldovenesc
  • JustAGuest Buna voce, costumul deja nu mai conteaza, macar nu ne va da de rusine...
  • Tina a vazut ca in anii trecuti nu a fost apreciata asa muzica, de ce mai incerca sa plece la eurovision
  • morgana Facepalm la gherman))
  • Vero Eu scriu cometurile de aici pe o foaie, ca tare-s de ris
  • shoimarel rupe tuzic grelca!
  • zozea catastrofa
  • guest_58 /hop
  • anjela de stres o slabit
  • booorisss cursuri de engleza intr-o saptamina vorbesti perfect
  • Metrun rap popular
  • lol cam nu-i clara piesa, prea multe strigate
  • mujiku waaaaaaaaay niku , malii blea
  • oana mariana ta n-are deloc voce si accent :))
  • limon offfff ce strigaturi face..ma sufoca
  • TZUTZA o sa se sperie europenii de noi cu asa o fumeie dezlantzuita pe scena
  • Serii si totusi Transbalkanika
  • Irina This is like a parody of Nelly Ciobanu's song. So true :)
  • lol.:) aaaaaaaaaaaaaaaaaaa
  • emily pazastini Doamne de asa cintareti.....
  • sasa7777 asa ca la moldoveni avem si noi cu ce ne mindri
  • eu si cum o trecut in finala
  • guest_122 ea a cata-i ?
  • j ura inca 7 au ramas
  • wizzzzzyy welcome to saint tropez
  • winnie the pooh :d:d:d
  • brăduţul velcăm
  • Natachyka du-te...............
  • olika pipettttttttttttt
  • lilia asta nu cinta dar rage
  • olika )))))))))))))))))))))))))))
  • killerkitty Mie mi'a plakut Mariana Mihaila,si cred ca ea va fi cistigatoarea...Voi ce ziceti?
  • FailEUROV ))))))))))))
  • marcik nu intseleg, de ce trebuie sa strigi asha?!! poate ea crede c anu se aude? :)
  • Marka da asta daca ajunge la Baku - si a sa cante welcome to Moldova - ia bred :)
  • eurovision welcome inapoi de unde ai venit
  • guest_38 chiar nu puteti face niste comentarii normale.. de parca ati fi ideali
  • Spectator duten pi**a matii
  • eu baietii respect
  • Cristinuta piesa e scrisa in cateva ore pe drum
  • brăduţul zicem că eşti retardat ca şi piesa
  • Runy deam mor di jale
  • ZZZ astept si eu Transbalkanica... macar ei sunt niste instrumentisti profesionisti
  • guest_58 @vero, fotografie, altfel nu credem
  • jfsd mihaila nici o sansa
  • guest_145 de slabit a slabit dar racnetul a ramas acelasi
  • Metrun Ea vsoce
  • 111 da,ea o sa kishtige ,Mariana Mihaila,a s citige kind a s kinte in piata centrala
  • iuh sadz ghinisor
  • oana :D nu da doamne mihaila sa ne reprezinte ca ma mut in alta tara :))
  • Milania ardeeeeee!!!!!!!! tot una!!!
  • mar va fi Mihaila cishtigatoare din alte motive, nu pu k merita ((
  • ADina Mie imi place DAra , dar vom vedea deja mai tirziu prestatia ei
  • lesy va fi, va cistiga intr-o butka in piata centrala :)))))
  • lily asta-i de tot..bunica bate toba...numa urla..cum se poate,dragii mei?chiar nu are autocritica?a-tzi auzut-o cum a strigat "volcam tu moldova"iaca asta engleza,nu shaga!
  • mujiku narmal
  • voronin primu loc de la urma pentru moldova e asigurat
  • ana super piesa nicoletei gavrilita o sustin bravooooooo
  • Engelhart ea striga de parca vorbea pe skype :))
  • Mishanea ii p...etu dak ii Mihaila sau Burlacu
  • limon daaa racnetul e vesnic in piesele sale
  • guest_10 da dj bobo este anu ista in finală??????
  • Metrun Batamnan vine pe scena
  • guest_49 imi place, der nui pt eurovision
  • iuh shii ku boitu asta??????fuuuuuu
  • lol.:) cool pesa oricum dekit altele
  • guest_73 Baieti , numai ce m-am conectat, puteti sa-mi n-am scapt nimic important ?
  • guest ei is machiati???
  • eu o piese cit de cit intreaga
  • solnishko ooooffff.....debili peste debili.....ashtia cn`s????
  • Cristinuta nu e urat nici asta... dar nimic deosebit
  • morgana numai nu gherman sau mihaila, va rog moldova))
  • guest_98 croitoru!croitoru!croitoru!
  • adelush ia uitaiva la aista shii abijanii.. vinat pe sub okii parkai ushis in fiecare zi :d:d:d
  • booorisss şi za pederaşti?????
  • alina afighenniieeeeeeeeeee,,ii votez,,,merita)))
  • iuh da is boiti parkasss fuuuh
  • liubo4ka M-Studio ii dragut, dar un pic de carisma nu ar fi stricat
  • guest_122 ii pozitiva pirsa asta
  • nietzsche piesa ushoara,buna la suflet )) merge la un chill out!
  • buburuza ++++++ ea striga de parca vorbea pe skype )))))
  • winnie the pooh cîntecul aș spune eu că-i bunicel, numai că ei sunt prea pletoși :D :)
  • mar vampirii)))
  • olika avem si noi lordi daa????
  • guest draguta piesa, dar nu pentru eurovision
  • Tina nu-s interesante de loc piesele anul acesta
  • Strangler parca-s travestiti
  • Natachyka Mai bine ca ceilalţi
  • guest_159 la ghitara canta padrugsa?
  • liolik ciuvaku ista vapse rupe
  • lesy matinka s-o scapat la pudra si farduri astiaa lol :)))
  • Runy Mia placut Geta
  • marcel bravo nicoleta gavrilita ai o voce super
  • ZZZ M-Studio par ok. Pacat ca lumea prefera zbieratul la aia dinainte sau alde jeta...
  • Natachyka Partea instrumentala e super
  • lol ey las ca nu mai este asa de rau
  • guest_40 imi plac nu stiu de ce
  • Nica place asta
  • clau au dat-o toţi cu fulare pe la gât.mda
  • arthemis nu e rau- dar nu va aprecia nimeni la eurovision...
  • lol sa'i spele..sa'i tunda si cu niste haine cit de cit mai adecvate... makar nu tipa disperati
  • stiopa unde-s mesajele mele ca nu apar
  • tina din taoate piesele asta e cea mai buna
  • Natachyka Look-ul lasă de dorit, dar nu e pe asta
  • oana haha :)))
  • cena homo style
  • Metrun o-0
  • guest_130 неплохишь!!
  • Aniuta wow, sunt bravoooo!!!
  • hhgj concenii
  • guest_40 deacord cu arthemis
  • phillo cel putin au un stil aparte
  • irina cu fulare, sa se spanzure dupa show!
  • 111 Mihaila ii da binisor pe unde trebu!
  • Mishanea De loc nu-s interesante piesele
  • iuh dar cinta binisor nam ce spune,dragut
  • Aniuta eu sunt pentru ei sau Manciu sau Parfeni
  • Herokiller Parca o fost la spalatoria auto si nea spalat botu cu Kerkerul ))
  • guest_122 chiar e buna
  • zayka parca ar si papagal la infatisare
  • guest place!
  • djzmc nu prea
  • buburuza gay and fake
  • Cristina) placut
  • nietzsche datzi sai trimitem pe astia... sunt buni!kiar sunt buni ))
  • limon eeeeeeeeeeeeeeeee extravaaaaaaagant de toooot
  • j muzica au .. da vor trece ? nu cred
  • puf daca stateau simplu pe scaune era altceva
  • guest_158 da da instrumentalu e bun , partea vocala si pronuntie mai trebuie lucrat :)
  • guest_145 baietii is talentati
  • djzmc nu prea
  • oana parca sunt gay))
  • guest_200 ei sunt din Garda tinara
  • FullyAlive mda...MD mai are mult dat din coate la capitolul muzica >> (((
  • Kristinuta ei nu arata chiar bine,dar piesa e bunisoara
  • florida imi place cum se misca
  • ADina ujas
  • patnurush aniuta , du-te şi prăşăşte cactuşi
  • Suruceanu nu eu cred ca ori Parfeny ori Akord
  • Metrun Ohaha
  • lol.:) +1 imi placa
  • arji steopa tu nu acolo scrii
  • zaibisi in orshi kaz mai buni ka predidushie
  • f buna piesa
  • patnurush mai mănîncă banane cu tot cu coajă
  • arthemis dintre toti- ar merita putin ai mul respect astia
  • guest_10 Zverev otdîhaet
  • Herokiller Oana nu cumva inveti la medicina ??
  • Natasha` mersy)) :D
  • ion sau ce p..a mea ii asta ca parca chiar daca votati o sa cistige in chi..a matii acela acolo ii stiut cine se va duce la baku
  • 111 asta trebuie imaginea de indreptat!
  • eu medleak
  • kkkkkkk da makar astia de s-ar duce
  • Nata croitoru e buna)
  • asa12 piesa frumoasa si canta bine live
  • iuh irinacu fulare, sa se spanzure dupa show!----spinzura-te tu!!!!
  • solnishko :d:d:d:d:datsi vazut slovenia? :d
  • cena Transbalcanica - Balkan Riders
  • alex cintecul e bunicel dar e prea monoton,si inka ceva ...nu vad sensul ochilor negri vopsiti!!!
  • mujiku fa lida fa
  • ngelish o iaka Gulko e bravo, bun cantec
  • Metrun The end
  • Banditos O boje, iak shi o pisla :))))))))
  • guest_237 marcel stefanet si prietenii lui o sa face ceva miscare
  • oana nu :)) dc?
  • stiopa cine credeti care va fi cashtigatorul ?
  • Serioja Ma gindesc ca sau Pasha sau Transbalkanika
  • true oparita
  • mar fuuu
  • alina o Boje....aaaaaaaaaaaaaaaaaaaaaaaaaa
  • eu o detonat
  • TZUTZA banal
  • dfg lumeeee da ce naiba... îngheață artiștii pe scenă... de au toți fulare?...le-o tăiat căldura celor de la TRM?
  • 111 fuck!!!!!!!!
  • Runy inceputul nu pare rau
  • cena cred ca Transbalcanica - Balkan Riders
  • dony marcel stefanet
  • one2 Dara merita sa plece la Eurovision!
  • Bloodvik Pasha sau Alexandru ori TransBalcanic
  • j oioi oi oi... aaaaaaaaaiiieeeaaaaaaaaavvv
  • ZZZ Transbalkanica sau M studio sau Ana Gulko sau GAv
  • FullyAlive e buna ...
  • oana mie dara imi place :) imi pare rau ca ia-u scos pe sun stroke project shi olia tira
  • Sky ce-i cu dinsa?
  • limon numi place delok
  • morgana akord, dara, transbalkanika, pasha
  • euro hreni
  • Banditos mii greatza de fata asta :)) alunela
  • urski ia shi leshinata :D
  • Metrun trebuia sa venit justin bibar sigur luam premiu intii
  • guest_10 fata asta o invatat engleza de la Băsescu
  • mikutza Mai repede sa cinte Dara...
  • Herokiller Intreb si eu din curiozitate )
  • morgana ah si manciu
  • guest_49 omg!
  • guest_145 Anul acetsa pleaca Cristina Croitoru
  • Marka stati acasa dragi moldoveni
  • guest_166 daca transbalcanica nu bagau o manea cu niste fragmente bunicele erau sanse
  • guest_49 si porno!
  • true shi krakanata
  • arthemis intr-adevar anul acesta chiar nu avem cu ce ne lauda... Pacat!
  • Cristina) alunela,..wahahah
  • elena voscoboinik uuuuuuuuuuuuurit de tot cei cu tine fata draga esti oparita de tipi asa
  • ZZZ in sf. cineva care nu e in rosu :D
  • oana cum credeti castigatorul e ales inca inainte de concurs sau nu?
  • eu ooooo tenor...cint si eu asa
  • solnishko Oooooooooooofffffffff.........................Shi`i dibilizmu`ista..........shi kiar in toata Moldova nu`s kintareti ormali....piese normale?>................M`ai ghini m`am pushk dekit s`askult tat asta`!...........Dap ce`asta`i eurovision?
  • cena Poti sa adormi
  • guest_122 si amu scoate rochia...
  • ea ini pare ca acus as adoarma pe scena))))
  • eu ooo..saxofonu rupe, restu fuuuu
  • liubo4ka cam greoi merge vocea..
  • ))) piesa nu kear potrivita
  • JustAGuest de fapt ea foarte bine cinta...
  • Bloodvik arthemis - deacord cu tine
  • limon parca e muzica erotica
  • guest_122 11 si 15 sint buni
  • guest_20 la mine o fugit motanu din camera cand o auzito ))
  • guest_166 doamne, cine o scris piesa asta, o baut tare
  • limon imi pare ca vrea sa lesine
  • guest_159 niste smaska sheva nar strica, skirtzie cam tare
  • mar vocea nui e potrivita pu piesa
  • guest e faina tipa asta. Ca Malta de obicei
  • shoimarel trebu de bagat nr 22 careva ca 21 astia is gravi bolnavi!
  • guest_145 ea e buna de dus pe Costa Concordia
  • oana ok canta mult mai bine ca de ex. gherman dar piesa chiar nui de eurovision
  • guest ca fon muzical merge.. dar ca piesa la Eurovision categoric nu!
  • TZUTZA ma dor urekile, geezazz!!!!!!!!
  • ))) guest _ 20 :DDD
  • Serii Urmatori is cei mai buni
  • euro eu dorm
  • andreea prin ce e pornografie ?
  • j 30 sec si am scapat
  • Engelhart la piese d'astea eu ma duca sa-mi facu un sandwich! :)
  • irina e colega mea, Ana canta, spre deosebire de altii.
  • cena hai dezbracate lejer in ritm cu muzica
  • true adorm
  • JustAGuest e piesa ei, cuvinte si muzica
  • phillo are in voce ceva special...da' voi sinteti niste ratati care nu faceti alceva decit sa comentati aiurea
  • aliosha eu stau aici mai mult ca sa citesc comentariile :D
  • iuh voce calda
  • guest_122 si-i cu ghitara asta?
  • ZZZ e mult mai buna ca precedentele.
  • ciofirlika i'm scres :S
  • M1 aishi de plins trebuie!! ujasnaaa!!
  • Metrun Z::::::::::::::/;;;;;;/
  • patnurush irina , mai bine dă dule la vrăghii decît să vorbeşti prostii
  • funny o cantat bine...gura mica!
  • ngelish serios....comentati ca nishte prosti, ratatzi. Pe totzi ii faceti de nimic. Fu tocmai, mai bine nici nu puneau aici chat.
  • TZUTZA aliosha eu tot!!! ei shi deamu trag un oki si la eurovisionu ista levii
  • guest_10 ooo, iar vin prezentatorii ceea ratați
  • limon the end..
  • ciofirlika ce numar este acum?
  • urski uraaaaaaaaaaaaaa,o terminat
  • eu reclama pentr-o o saptamina
  • eurovission naveti nici un pic de omenie in voi, vorbiti mai frumos si nu injureati atita caci nu shtiti cita munca se depune pentru asta pentru asa show, nesimtitilor...dativa cu parerile da nu injyrati
  • olika la ce pariem ca anul acesta nici in finala nu intram fratilor
  • j -phillo- nu fii moralist. ficare scrie ce vrea. vocea e bina da o ia razna cate odata nu e sigura
  • oana credeti ca olia tira si sunstroke project au fost descalificati pe nedrept? mie personal chiar imi place piesa lor
  • patnurush aliosha , eşti laş
  • elena voscoboinik face ca mersi mult dute in p...a matii da proasta teo mai facut mamta ca puteai sa zici multumnesc ca nu sintem romani
  • mda numa rau vedeti...asa e poporul moldovenesc..nu sunt multumiti cu nimic... de criticat toti sunt buni...
  • Banditos da, suntem proshti shi ratatzi, tu ce cautzi printre noi?:D
  • guest prezentatorul Anatolie face circ, se da in spectacol. Nu-mi place, exagereaza!
  • cena urmatoarea piesa e the best : Transbalcanica - Balkan Riders
  • Metrun Rclama
  • oana olika sunt deacord :)) o sa ne facem de rusine mai tare ca niciodata
  • TZUTZA pai se depune munca si bani aiurea in eurovisionu ista. Moldovenii inca n-au intzeles ca nu merita nimeni sa ne reprezinte????
  • guest_93 rahat cu stafide
  • euro eu acum ascult pe youtube disturbed iaca asta-i muzica
  • guest_132 Da terminati sa va certati ca niste gaini
  • limon ia sa vedem mai departe...va fi oare cineva destoinic sa plece la eurovision la BAKu???
  • moi si pe privesc.eu publicitate ?!
  • guest_32 nu au intelesssssssssssss
  • Serii iaca reclama asta nu o trebuit , multi schimba canalul si scapa cintecut , da cintecul e cel mai bun
  • andreea eu cred ca are shanse pasha asta sa cashtige la noi , insa la Baku nu-l vad pe un loc de frunte ... parerea mea desi mi-ar placea sa gresesc :)
  • eurovission eu nu vorbesc de cineva in parte sau de interpreti eu vam rugat sa nu injurati in direct si nu dati dovada de animalism....
  • morgana mie imi pare ca cea mai buna editie a fost prima, cand zdubii au castigat si aurelia vasilica a prezentat!
  • j Astea si am scapat: 17 Transbalcanica “Balkan Riders” 18 Dara “Open your eyes” 19 Univox “Moody Numbers” 20 Akord „Live The Show” 21 INAYA “Lights”
  • elena voscoboinik da tu ceai crezut
  • lol,,:) molped :ddd
  • marusea ei , are branza, transbalcanica o bagat o manea...instrumentele bine manuite inca nu inseamna succes garantat
  • guest_132 da dupa kum vezi
  • ha cei care mai scrieti ceva negativ despre cintareti sunteti niste pid..i
  • Radu Privesc.Eu nu face publicitate la MOLPED
  • Engelhart mie numi place piesa celor de la Transbalkanica, desi ii respect ca muzicanti, dar piesa de anuul asta seamana cu cv oriental sau cu o manea ((
  • olguta27 :))
  • Victor bai Limmon tsaran ibu4ii..in Baku..da nu LA BAKU
  • ha ian sa vedem caare din voi este p....?
  • patnurush ia tăţ gurile nna
  • piton doinita gherman merita sa se duca la eurovision. prestatia super, miscare scenica plus voce,are tot paketul. iuuuhuu doinita!!
  • eu molped pentru cei care stau rau pe cheat
  • Metrun @-@
  • kira Doinitza e o rulada de carne, vacutza!
  • morgana piton, tu iti dai seama ce vb???
  • guest_175 gherman doinutza-capritza
  • Milania Victor ))+1
  • solnishko :D:D:D:D:D:D piton...ai kikat in kap ....?gherman??????Ma faci sa rid :d
  • Serii Fiecare cu gusturile sale
  • guest_132 hahahahahahahhahahaha de ce va certati de parka voi stati acolo:d
  • ha opa iata un pi...
  • j da muzica la transbalcanica nu e cea mai buna dar aproape de a semena cu ceva bun de concurs,, de rand cu Pasa si altii vreo 3
  • TZUTZA ma duc eu la wc
  • olguta27 asa si a zis la baku
  • Metrun Gusturile nu se discuta
  • andreea piton doinitza va plateshte ? sper si ma rog din tot sufletul sa nu o vad pe asta in timpul apropiat
  • FluBBeR care-mi spune unde pot vota online???
  • euro m-am saturat de reclama
  • Vero da voi stiti ca azi merge si Fabrica de Staruri?
  • anka may doinitsa gherman e ft. distractiva si fun,dar nu pu eurovisionul de l baku
  • Victor TZUTZA pe nimeni nu fute unde tu te duci))
  • eu+eu imi pare ca sunetul cam dispare
  • ADina online nu poti vota
  • elena bai da cei grasa goinita mai bine sar duce la o sala de sport.... iar merege foarte bine si dupa aia las sa vina aici la eurovision
  • j la telefon
  • dafaq..?! Victor +1
  • anka poti vota online??
  • guest_122 cam toti merita sa plece la eurovision, dar din banii lor si sa vada ce inseamna show format eurovision
  • Suruceanu nu poti vota online
  • euro korona
  • limon Victor..un pik vocabularul te da de gol...ce educatie proasta ai
  • haszart cate piese tre sa mai cante?
  • ha care mai scrie astazi pe acest site este pid..
  • ha care mai scrie astazi pe acest site este pid..
  • ha care mai scrie astazi pe acest site este pid..
  • Mihaela Ce vatzi legat de doinitza ce va fc?
  • ha care mai scrie astazi pe acest site este pid..
  • Natasha` cind merge fabrika?
  • ha care mai scrie astazi pe acest site este pid..
  • ha care mai scrie astazi pe acest site este pid..
  • Natasha` la ce ora?
  • elena ian spunetimi cui nui place de nicoleta gavrilita hai ziceti va rog
  • morgana iaka la korona tot canta padruga lui zarizma))
  • marusea ce calitate nasoala, nu poti vedea calumea nicaieri, pauze peste pauze
  • ha care mai scrie astazi pe acest site este pid..
  • elena dar si de ce
  • lol,,:) ha... kam kit ani?
  • piton sunteti niste invidiosi, doinita e cea mai buna
  • mmm... ....eurovision lume multa si frumoasa...doar atit,,,chiar am ajuns la vorbele lui Turcu
  • Oleg Voronin iaca eu chiar scriu astazi pe acest site
  • anka marusea cred ca internetul tau nu prinde ft. bn..sau ai prea multe pagini deschise
  • Metrun Tu esti pidar ai
  • guest_40 draga ha, gluma ta e rasuflata si ocupa loc degeaba.
  • TZUTZA gata , am venit de la wc
  • morgana HA, tu esti cel mai mare atunci ;)
  • helou ha.. u deja esti de 5 ori pi...:D :D
  • dony mia nu
  • cena Transbalcanica - Balkan Riders The Best
  • guest_98 mariana mihaila !!!!!!!!!!!!!!!!!
  • Victor Limon..Credema ma pe mine..pentru cunostintele pe care eu le detin..ai ink mult de muncit ca sa le capeti
  • andreea elena , pravilina ... e important si fizicul la eurovision asha ca sa mearga la sala
  • Cristina cum poti vota online?
  • euuu toata publicitatea in rusa
  • mujiku sinii pidar?
  • om marcel la baku!!!!!11
  • morgana asta ii alta prezentatoare sau ea si-a schimbat coafura si imbracamintea??
  • lol iaka si cristina
  • Suruceanu citi au cintat pina acum?
  • j Cristina doar la telefon
  • patnurush blea!
  • cena Transbalcanica - Balkan Riders The Best
  • marusea pacat ca n-a participat catalin josan din partea moldovei, macar nu era pornografia asta cu german, gavrilita si altii
  • cena Transbalcanica - Balkan Riders The Best
  • solnishko dibiliam~la gradul superior.........
  • arthur e super nicoleta gavrilita
  • anka ce urata e prezentatoarea :)))
  • offff ce prezentatori..............
  • ZZZ Manchester U. e pe primul loc!!
  • Victor TZUTZA pe nimeni nu fute unde ai fost tu))
  • j au rams inca %
  • j 5
  • Cristina parca spuneau ca si pe net!!!!
  • piton anatol esti o oaie
  • morgana Manchester untied go go go!
  • euro ursuuuuuuu
  • piton concenii evravidenie, toti is niste ratati
  • anka cn a cantat pa
  • anka cn a cantat pa
  • JustAGuest ma enerveaza cum vorbeste prezentatoarea, parca are ceva in gura, inafara de limba...
  • TZUTZA Viktor. esti cam stresat baiete.
  • anka cine a cantat pina acum?
  • eu+eu laudaros
  • mikutza numarul 18 cel mai bun...super
  • albot ei tsipa mai talentat decat canta :D
  • guest_122 care fani???
  • offff evolutia.....din cushca
  • moi eu is fan a lu adrian ursu
  • cena Transbalcanica - Balkan Riders The Best
  • guest_159 undei lisapetu?
  • guest_32 hai ma , iar barfeala
  • j cine vorbeste de rau de altii vorbesc cu raul din sine :-) fiti atenti ce ziceti
  • moi nu, nu-s gomic :)
  • cena Transbalcanica - Balkan Riders The Best
  • marusea da la adrian ursu tot ce au gasit o bagat in scena, care-o fost sensul la tot marafetul? si ce folos daca cantecul e aiurea
  • guest_32 aratati concursul
  • Victor NU pur si simplu eu am trecut de adolescenta..lukru pe care tu ink treb sa-l faci
  • j anka au ramas 17 Transbalcanica “Balkan Riders” 18 Dara “Open your eyes” 19 Univox “Moody Numbers” 20 Akord „Live The Show” 21 INAYA “Lights”
  • guest_122 tu esti moi..
  • Vero cubul lui Ursu e scut antipatlajeli
  • A voi toti sunteti niste oi
  • euro cam ii timid Lucifer
  • Metrun Asela u luat foc
  • Irina mai bine era Adrian Ursu himself, si era sa mearga mai bine
  • buburuza Еврох**та какаята, товарищи !
  • limon Victor..nu e cazul sa faci diferente intre noi..fara ca sa detii ceva informatii despre mine..si nu imi ataca persoana mea..cred ca m-am exprimat destul de clar
  • Natachyka E increzut in sine Ursu
  • offfff unde sunt fanii de la ringstarrr ... nu va auuud)))
  • WTF ziua
  • lol,,:) bun ziua axaxaxa:dddddddddddd
  • plinbarila dece piesa lui adrian ursu e super
  • Cristina Adrian Ursu LOL :)))))))))))))))))))))))))
  • Topo oooo nuuuuuuuuuu...Ghermannnn
  • guest_32 Ursu va eplica mereu istorioara... bla, bla
  • TZUTZA bai victor , ian nu ma-nnerva cu kestii gen adolescenta and bla bla. tu nu stii cati ani am eu.
  • )) Vero:cubul lui Ursu e scut antipatlajeli..ahahahhahahha
  • marcik of, iar femeiea asta in calduri :))
  • urski debila asta roscata
  • marusea da, poate pentru radio noroc piesa lui ursu e tare ok
  • mindfucker doinitza e nebuna =))))
  • kira beteaga asta de Gherman!
  • guest_122 oaaaieee
  • eu ragusita si nebunatica ii rea de tot
  • Fuuuu si oaie
  • Vero ))
  • lol OMG )))))))))))))))))))))))))))))))))))))))))))))))))))))))))
  • victor numai la mine merge in frame-uri?in reluare si cu lag?
  • M1 ii ragushita
  • Suruceanu tineteo ca delireaza
  • piton priponitso pe doinitsa
  • cena Transbalcanica - Balkan Riders The Best, votatii ca sunt cei mai buni anul acesta, ceilalti is sucks
  • guest_40 Vero: cubul lui Ursu e scut antipatlajeli ))))))))))))))))))))))
  • marcik tsinetsi-o!!! otpustite eie v ghimalai!! :)))
  • eu pff cik engmatic ;D
  • mujiku way tat o sa shie ghini
  • Natasha` ce parca-i sub caif??pff
  • elena daca esti o .... doinita gherman sincer parca esti bata
  • guest_122 la aista tableta ii in lionca:))))
  • Stefy Sunt unii care chiar cinta bine de exemplu Dara am auzito cintand si e super.Adrian ursu la fel a cintat bine.Cristina croitore e cool si asa mai departe> se gasesc altii mai destepti sa ii critice pe toti si sa vb foarte fromos.Daca nu va place nu va uitati da tot vb prostii
  • Fuuuu duhuuu nostru bleaaaa
  • buburuza are cineva otrava, sa ma sinucid?
  • Olga mare debila
  • eu cine acolo cu Dara hi5! eu tot sunt cu Dara!
  • WTF DUHU,wai tzarani Duhu waaai
  • marusea fata nu tipa ca se aude
  • Victor Da dak ai trecut de adolescenta..asta inca e si mai tragic..Ca o persoana dupa 18 ani sa scrie prostiile pe care le scrii tu)
  • guest_159 doinita gherman procuror general!
  • Scotland She's mental
  • offfff duhu e dus la italia)))
  • guest_122 tableta in pleonca!!!
  • guest_88 dar unde sunt lista participantilor pentru votare?
  • Engelhart #victor - nu nu mai la tn merge pe frameuri laguri samd
  • A nu inkurka nunta ku eurovisionul
  • om să'l pupi la ciuleandră
  • Pavel turcu eu!
  • Miha o baut din lampa fermecata
  • doremi gherman e beata
  • ciofirlika parca ii ametita :D
  • Spectator da au ceva sppecific un zurgalau in ureche
  • Irina chiar e beata
  • )) ooo cumanioc
  • guest_122 aistea is buni oleaca
  • buhuhuhuh am venit la evrovidenie cu cumatru )))
  • cena buburuza, am deaceea p/u sobolani, iti dau gratis
  • Nu-s artisti in moldova! Moldova trebuie sa iasa din concurs
  • lol,,:) cel mai bun piesa kiar...
  • moi vioara e super
  • offfff oiii blin...rupe vioara
  • Cristina ahuena cinta!
  • kyoko tatz is gata sa mearga la Bacu dar nimeni din cei ce au cintat pina acum nu merita .....
  • reew cine-mi spune unde gasesc lista cu participanti pentru vot
  • kukurigu offfffffff lume unde se pornesk astia ne dau tara de rusine
  • Metrun da
  • iulia inca citi ttrebuie sa mai cinte?
  • ciofirlika abia astept sa cinte trasnsbalkanika
  • haha hahhaha
  • euro aista cu scripka e super
  • mikutza eu...pot sa ma alatur...Dara super....
  • marusea baietii astia-s buni da piesa mai trebuie un pic lucrata
  • A pe linga tiganii de la Soroka se odihneste asta ku vioara
  • guest_32 oo cumatrism pe aici
  • Irina Mi'e si rusine cum isi bat joc de noi o lume intreaga pe tweeter si diverse retele de socializare :(
  • nicoleta Daraaaa we are with you!
  • nicoleta Daraaaa we are with you!
  • guest_32 cineva a recunoscut macar
  • ADina da da DAra e minunata , astept sa cinte
  • kuku ou)))
  • anka dara!dara!dara!!!!!!!!!!!!!!!!!!!!!!
  • TZUTZA victor,off. tot ce-i scris aici e mai mult poprikolu. hai lasa jalea , bun? concentreaza-te la EUROVISION.
  • guest_39 e buna piesa lu Parfeni ,astept si transbalcanika:D
  • porecla de ce canta asta cu microfonul marsul de inmormintare?
  • euro offfffff
  • buburuza otrava de sobolani, mananc in fiecare zi, ascultand stirile in fiecare zi.. ceva mai tare )))
  • kukurigu une se porneste ririita asta
  • Serii serios?)))
  • Vero priviti cum comenteaza strainii pe http://www.eurovision.tv/esctv :If I was Moldovian, I'd be so ashamed right now. Cut the crap and send Sunstrock Project!!!
  • mujiku bagrhradaci
  • anka a cata e dara?
  • cena Transbalcanica - Balkan Riders The Best
  • A oi proaste
  • euro cine-i dara?
  • lol,,:) arrrr
  • kyoko iaka si printesa adormita
  • Spectator s-a blocat
  • kukurigu tute fato cine o sa te voteze
  • Victor ok tsaran fie asa cum zici tu))
  • guest_5 Bafta Dara!!!
  • Все Бездари собрались Только бездари в этом конкурсе
  • cena Transbalcanica - Balkan Riders The Best
  • A nu se duce numeni la eurovision
  • j lista http://trm.md/ro/social/cine-merge-la-baku-decidem-acum/
  • alex intr-adevar cine mi pune prezentatoare la eurovision o rrrita?
  • guest_40 Dara s-a lansat duminică, de aceea e puțin cunoscută, dar e foarte bună
  • kukurigu offfffffff nici nu ai pe cine vota
  • patnurush ,ii jale de moldova ))
  • Stefy Dara e cea mai tanara concurenta daca nu ma gresesc ,cinta super numarul 18
  • limon hey Victor..eu ca persoana ma abtin de comentarii de prost gust,ar fi de dorit sa iti mai cenzurezi un pik vocabularul p-u a nu face impresie gresita celorlalti..nu e un sfat...
  • mikutza Succes tie Dara...meriti..
  • patnurush va doresc o noaptze far de auditia acestor piese ===
  • cena Transbalcanica - Balkan Riders The Best
  • ADina Dara intradevar are o voce minunata si o piesa buna
  • offff eiiii foarte multe emotii in green room....dar la voi aici...park sunteti la priveghi,,,
  • Все Бездари собрались Я зашёл посмотреть митинг ПКРМ, а здесь эта Евровидения с бездарями!
  • two1 Eu votez Dara!
  • alinuta333 dara
  • mujiku orange stinge lumina odata sh dute akasa
  • Tigra spuneti-mi va rog mult, unde putem lasa comentariile pe care le citise Anatol? )
  • buburuza eu sunt cu moldcelu :P
  • j 17 Transbalcanica “Balkan Riders” 18 Dara “Open your eyes” 19 Univox “Moody Numbers” 20 Akord „Live The Show” 21 INAYA “Lights”
  • anka dada miam amintit,e a 18a
  • irina se mai difuzeaza online undeva Eurovizionul ?
  • Radu dar dara când cântă?
  • cena Transbalcanica - Balkan Riders The Best
  • guest_205 daraaaa
  • Metrun Cruta
  • kukurigu ce urla prezentatoarea asta de 2 bani
  • Cristina da ele sunt doua prezentatoare??? ka era si cu parul drept acum iar cu cret!
  • Victor Limon..dar ce cumva vreo amenintare)?
  • aliosha vreu sa o vad si eu pe Dara deja
  • rodika daca totzi interpretii ar fi ca Donitza Gherman ar fi grav de tot
  • Irina http://www.eurovision.tv/esctv/main?program=48443
  • Все Бездари собрались жос альянс!!!!!
  • urski nu,nu,nu-i treaba buna chestia asta...guvernu tre sa aleaga
  • XXX daraaaaaaaa!!!! go go go!!!!!<3
  • sunt eu mi-ar fi placut sa prezinte dianna rotaru!!!
  • kyoko oooo ceva normal
  • Stefy E numaru 18
  • Serii iaca astea imi plac , fata de restu macar au fata
  • kit oo superba piesa
  • guest_32 suntem la privechi pentru ca vedem cum ne facem de rusine ... Moldova Eurovison Fail!!!
  • two1 manele la refren! srica tot!!!
  • miki paralela 47 a cintat deja?
  • cena Transbalcanica - Balkan Riders The Best
  • TZUTZA Da , Viktoras. ai grija cum vorbesti.
  • anka dada p siteul trm.md si gaseste unde e liveul
  • ?? cred ca e ceva bu
  • A oi proaste
  • j start bun si instrumentisti !
  • Cristina miki: da
  • Metrun da
  • Herokiller miki -da
  • clau da miki
  • guest_12 miki,da
  • doremi a cintat si au ars
  • alinuta333 cei asta?
  • Все Бездари собрались жос гимпу, жос лупу , жос филат!!!
  • Engelhart #miki - inka nu
  • Nata tg
  • Serii pi*datii cintec
  • ZZZ Transbalkanica - super!!! instrumentisti profesionisti! Succes!
  • kira Bravo baietii!
  • dana da, ei au fost nr. 5
  • tzambal narnal:)
  • anka vad k pe net dara are multi fani <33
  • eu ooooo tambal si imi pare ca cinta barancea
  • kukurigu inceputu ii bun
  • ciofirlika solistele astea strica tot cintecul
  • guest_215 super!!!!!!!!!!!!!!
  • guest_38 astia s buni
  • VLADIMIR VORONIN mariiana mihaila best!!!!!!!!!!!!!
  • alinuta333 dece nu merge
  • www acea neagra strica tot
  • limon Victor..pe mine nu ma reprezinta faptul da fac amenintari la adresa unei persoane,si inca necunoscute...nu e cazul meu
  • Topo oooo...iaca asta e tema))
  • JustAGuest bravoooooooo.......profesionisti!
  • miki ehh iam scapat...macar cum au cintat?
  • irina ce costume...
  • winnie the pooh nu-i rău :)
  • j vocile cam aiuerea da ser resyul sa compenseze
  • Scotland this is shit
  • mikutza Dara bate pe toti...
  • A oi proaste
  • guest de unde o luat solistele astea?
  • djzmc boule
  • arji super
  • ?? oare ea va pleca
  • Amy Super
  • Bloodvik Baieti astea 2 fete au glas rau de tot , instrumental rupe
  • guest_38 superr
  • offff costumatie de mortal kombat....wtf???
  • lol fuuuuuuuuuuuuuuuu
  • Serii vioara rupe...bun cintecu
  • j neagra cam ...
  • guest_175 trasbalkanika- doua mate
  • guest_132 fetele kinta bine nu vb prostii
  • guest_94 Vocile foarte slabe... Pacat, instrumentistii sunt buni
  • Metrun nui buna
  • guest_20 mai bine taceau ca mizica mai merge)0
  • urski merge,merge
  • kkkkkkk vocile fetelor sint prea pitzigaiate
  • irina vad mult mai dinamica prestatia scenica...cam timide fetele...instrumente suna destul de fain
  • guest_59 cam gâtuit
  • j doar ca face trilluri specifice
  • Irina a inceput bine, da' vocile astea 2 ma dau jos :( fuuu
  • morgana The tension is rising in the Green Room in Moldova. It will all end in tears when the vodka runs out (pe alt site)
  • Cristina nu prea bine li se primeste)))
  • lilia nu mai sunt asa de buni astia, fetele nu au nici o miscare scenica.... e asa si asa..
  • Runy doamne ce rochii...
  • Victor Limon..ap dak nu te reprezinta..inchide ibaliniku))))))
  • j mai au nevoie de o voce puternica cumva acolo
  • .... DARA, noi te sustinem!!!
  • anka daraaaaaaaaaaaaaaaaaaaaa
  • ZZZ Marcel rupe tot!
  • guest ce-i cu manelistele astea...strcica toata imaginea trasnbalkanicii...nici nu pot ridica notele ...doamne
  • nutza frumos
  • kyoko parka nau minkat de dimineata
  • sherlock si cine acolo zicea ca transbalcanica sunt buni?eu n`ash zice
  • Victor Offf....nu ma pot opri de ris cu voi baietsi))))))
  • lilia instrumetistii sunt buni
  • A daca sa nu cinte e buin
  • Topo instrumentele ruuuuuppppp
  • El Commander tziganii si inoplanitenii!
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • Bloodvik Kyoko - ooo respect tie :D:D
  • WTF ii pesnea shi cu aieshtia
  • lol au emotii fetele si vreti ...
  • andreea spune-ti si mie cine-s ashtea ca am pierdut inceputul?
  • morgana baietii is buni, dar fetele cam slabe
  • Olga nu prea se combina vocile lor
  • phillo imi place vocea brunetei
  • www spune NU manelelor !
  • Soarele mai multa reklama dekit calitate
  • coco channel imi pare, sau piesa asta e furata..??
  • TZUTZA bai Viktor. tare ti-as mai spune vreo 2 , dar ma abtin. ca is fata edukata. asha ca.. idi guleai.
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • liubo4ka cred ca is buni strategic, vor lua cele mai multe posibile voturi pt Moldova. Balcanii ii vor vota
  • guest_175 ce levaaaaaaaaaaaa
  • tina instrumental Da....vocal NU
  • limon Victor..cit de vulgar poti vorbi..asta nu iti va face fata niciodata..
  • guest ce-mi pare rau de cintecul acesta....l-au stricat doua maneliste
  • irka eu zic sa le scoata pe pipotele astea....doamne motanu meu si to miauna mai bine
  • sweety tare leva
  • ZZZ Bravo baieti! Melodia asta imi place!
  • A oi proaste
  • euro numa instrumentele sunau bine
  • eu Eu cred ca o sa castice ori dara ori transbalkanika ori urrsu(mai precis DARA
  • nicoleta Dara!!! a venit
  • arji au sanse eu cred
  • WTF DAra go go go
  • nutza cineiiiiiiii?????
  • guest_205 ooo hai dara
  • M eu din cauza lor trebu maine sa ma duc la Uhogorlonos-log
  • sherlock strasnicuta :/
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • coco channel imi pare sau piesa fetelor e furata?
  • tina da cintecul asta e bun Dara
  • urski ii buna tare----fata din dreapta si ce din stanga :D :D :D
  • mikutza La eurovision tre sa se duca o persoana cu o dictie tare buna ..engleza la nivel..prezentare scenica f.b...si o voce puternica...Dara e singura..
  • Mihaela Dara cinta inchidetziva gurile shi tastaturile
  • Radu ooooooooo.....
  • kukurigu kiti bani io dat oare taikasu la asta sa ajunga aici
  • Metrun inca cite sint
  • sati Voteaza Dara!
  • .... daraaa esti super!!!!go go go..
  • jOEcRAZY dara noi te sustinem
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • guest_154 Tzutza..eu nu am stiut ca esti domnisoara...atunci imi cer iertare
  • Vero Moldovan television must have used the wardrobe from every costume drama they ever made for their #eurovision show
  • euro hippy
  • ha seamana ea cu mosul papusa
  • lenna dara e super..
  • ........ melodia buna... dar vocile slabe....
  • guest_20 anita toi
  • lilia iata fata aceasta chiar cinta
  • WTF Dara sooopeerrr
  • winnie the pooh drăguț
  • ha ha ha ha
  • guest_130 ооооо
  • WTF soop[er
  • anka daraaaaaaaaaaaaaaaaa
  • milly dara ....emana pozitivism.....bravo
  • lilia bravo dara
  • Runy foarte fain
  • sweety de unde a aparut si pevitza asta?
  • guest_94 Oau... ce e de dragutza... si cinta bine!
  • tzambal ghitara mai pizdoasa nu o gasit?
  • nico the best
  • guest_192 :))
  • j poate de aici cineva? 18 Dara “Open your eyes” 19 Univox “Moody Numbers” 20 Akord „Live The Show” 21 INAYA “Lights
  • f_89 binisor
  • guest_94 Am sa o votez
  • olguta27 nice
  • JustAGuest suupeeeeer
  • WTF cinta sooooopeerr
  • Dina Dra e minunata
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • El Commander are...are ceva
  • Bloodvik bai eu nu zic ca e nu cinta frumos , da nui pentru Eurovision
  • guest foarte simpatica piesa
  • j Dara chiar canta..
  • muhha bravo Frumos!
  • euro cine-i pentru dara sinteti nebuni
  • guest_122 dara = baietii transbaikanika
  • Tatiana Frumos !
  • M1 e bravo!!!!
  • Puff Plăcut Surprinsă!!!
  • .... superrrrrrrr
  • kira e buna fata! Dar cred ca a ajuns cu multe ruble aici! Nu oricine isi poate lansa si un parfum!
  • nutza floricele pe cimpii hai sa le-aduam copii si dara fuge dupa ei :D:D
  • mikutza Votati sa nu ne facem de ris...Dara..inainte..num 18..
  • Milania picior de angelina joli))))
  • tina super
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • lol 18
  • Cristinuta Ghimpu-i de acord cu Voronin la eurovision si Voronin cu Ghimpu la alegerea presedintelui.. sa fie echitate
  • liubo4ka imi place
  • offff hai haii...inshetisor sh pe dreapta...
  • irinaa piesa buna, imi place, voce placuta..dar nu ptr eurovision, daca ar avea un concert la Kira's club m-as duce:))
  • Metrun oallalalalalalblalabla bla
  • shoimarel oo iaca las sa mearga fetita asta! chiar are talent!!!
  • guest_154 da pentru Limon...what can i say..i speak whatever i feel like speaking)) sa vedem poti traduce)))
  • guest nu ma asteptam sa cinte asha....si eu cint mai bine cintecul acesta...e foarte usor
  • buburuza +, dar e strasnica
  • urski pronuntie buna da inainte de asta cateva oua trebuia sa beie
  • phillo likee
  • lilia dara n-o sa ne faca de rusine la baku daca pleaca
  • guest_158 nu cheltuiti bani pe voturi ca nu conteaza ...oricum deja totul e decis
  • lol,,:) good pesa
  • ZZZ Imi place si melodia asta. Deja sunt 2: Transbalkanica si Dara :)
  • clau mmm.Dara.şi mesaj bun şi voce bunicică
  • guest_192 bravo
  • Kristinuta cintecul e bunisor
  • Dara nu votati pentru mine! Oameni buni votati pentru Asrian Ursu
  • guest nu e strashnica deloc.. e simpatica1
  • tidy eu votez dara!
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • angela jos Alianta!
  • nutza si cu zombii istea de linga disa
  • olesea mmm...destul de interesant...
  • guest_50 bun
  • j canta bine, dar putina energie da in jur entru asa concurs
  • Victor Guest 154 is deasemenea eu Limon
  • guest_253 mai bine canta in limba romana
  • je shii bolfoasa dara asta...ffff:d
  • guest o bagat tatsu la bani de cind avea vreo 5 ani
  • anka hoo de cand am trecut la politica???
  • guest_166 fetita asta e singura de bun gust
  • TZUTZA in sfarsit o piesa catusi de putin 'ascultabila'
  • Bloodvik angela :D tu si glumesti sau nu ai fost cu musarca in cap :D
  • guest_10 formatia Fresh participa anu ista???
  • guest_49 bravo dara
  • cuc totul e decis...merge adrian ursu?
  • guest transmite puritate piesa Darei...
  • Dina ador
  • guest_100 angela suge cucu!
  • ZZZ pe eurovision.tv toti lauda doar Transbalkanica...
  • anka je bine k u eshti frumos
  • urski inca oliac sh nu s vede nasu :D
  • guest_130 tare!!
  • tu m-ă știi je tu tei uitat la tine
  • El Commander privet Maria ! ;)
  • j angela laso balta cu politica, nmai dute- pe p.. ata din centru
  • dony si grasutza:d
  • eu e cam pe loc melodia dar e mai buna ca multe piese carea au mai cintat
  • guest_28 pt ce dramatizeaza si urla asa, strica piesa
  • ivanturbinca place piesa...si clip are
  • tidy bravo dara
  • Cristina asa si asa)))
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • Irina si ninja pentru ce's aici ?
  • nutza cintecul e frumos numai ca oamenii in negru nu trebu !!!
  • V.O. bravo!
  • andreea oameni aratati-va admiratia sau tot ce vreti voi intr-un mod acceptabil , rog cenzura in mesaje !
  • Puff Copii, se poate fără spam politic? măcar pînă la 23.00?
  • FluBBeR voronin suge kuku
  • coco channel super
  • WTF privet tina
  • Metrun Zombii sint romini nu vreu rominiii sa cistige
  • GHIMPU sunt deacord cu vladimir voronin, transbalcanica - balkan riders the best
  • A oi proaste
  • PLAHOTNIUK Ghimpu, ian mai tashi! ca fara mine, oricum nu faceti nimic
  • tina salut
  • lol,,:) param param
  • guest_160 univoxpot canta
  • guest_94 Amus...
  • kyoko aisi vapse ii pipetssssssssssssssss
  • guest_20 )))lol
  • Sky dafuq?
  • kuku auz...
  • M1 oii bliaaaaaaaa
  • WTF :d
  • M1 "d"d"d
  • guest_86 Si aistea a sa ne futa un cantisel amuiana???
  • Cristinuta Puff, se poate
  • mikutza super piesa..cea mai decenta..
  • guest_49 o! aste sunt foarte tari!!
  • ivanturbinca bravo dara
  • tzambal huuuuuuuuuuuuuineeeeeeaaa
  • guest_253 Dara Trebuie sa invinga
  • guest_25 ce fignea
  • @ ca de obicei nimic original, copie eurovision precedente, nu vom castiga niciodata...
  • ghita Open your Eyes si votati Dara.
  • guest_158 puff = victor ?:)
  • ivanturbinca cred ca ea merita sa cistige
  • Ooo Votati Ghena traktoristu!
  • guest_28 mudi mudiii
  • muhha )_)))
  • zalupu ))) fuuuuuuuuuuu
  • dony ca in desene animate
  • GRECEANII lasca la anu particip si eu la evrovizion!
  • guest_10 wtf
  • euro mudi mudi
  • B :dddddd oiaa :d
  • offff mai bine ascult ciocarlia
  • guest :d:d:d:
  • lol,,:) omgggggggggggggggggg
  • lilia hooo
  • j dara
  • coco channel fuuuu.. si cu nebunele astea??
  • Cristina fuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
  • eu lasati certurile e plin cheatul scrieti la tema succint si cu obiectii reale
  • Dina cei cu asta pe scena , doamne oribil :D:D:D:D
  • offff bugii bugiiiiiiiiii
  • guest_122 11.15.18-super
  • mudi mudi ))))
  • dony dute ku piesa ta naibii:d
  • Bloodvik Univox - Din toti are acent Englez ,restu cu engleza o dau dea ... :D
  • doremi )))))))))))))))))))))))))
  • andreea de unde Doamne au mai venit si ashtea ?
  • Metrun fįuuuuuuuuu
  • dorin super ...yes.yes,yes !!!!!
  • sweety fuuuuuuuuuuu
  • anka dooooamne fereshteeeeeeeeeeeeeeeeeeeeeee..........park ii la circ
  • limon wouu ....vad ca reprezint interes p-u cineva..
  • urski imi aduce aminte de portugalia 2011 si belgia
  • B Fuuuu
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • Ionutz cuuuum?
  • j o asta cantek, tara nebunilor si Molvina
  • guest_145 unicox
  • ha dedtzkii sad :))))
  • Cristinuta votati pentru norisori votati copilaria mudi mudi
  • ghita Eleva lui Pavel Turcu
  • guest transbalkanica would be nice if only the girls would shut up
  • Ooo Gradinita nr.402
  • stefania Aestea is varza in domeniul Cintat nis dracu nu ii primeste sa ii cante
  • guest_210 Bun venit la matineu
  • tu ce aiureala(
  • coco channel se screme ca o gaina ploata
  • ivanturbinca doamne fereste
  • Metrun sufla vintu in cap
  • ea sii cu viata lor?...))))parca sintem la detskii sad Romaska)))00
  • aliosha pozooor!
  • guest pe alt site comenteza asha :transbalkanica would be nice if only the girls would shut up
  • kit ujasssssssssssssssssssssssssss
  • je park is la gradinita
  • TZUTZA mai sunt inca multi??? nu shtiu cum altii.. dar eu m-am saturat sa tot ascult rahat da nu muzika
  • dony inkide gura fa
  • vind un par din cur prostii
  • winnie the pooh Alice in Wonderland???
  • ........ offffff ujas... de unde o iesit
  • guest_197 Doamne fereste...
  • buburuza cei cu pedofelia asta?
  • B Mai au mult sa neaune??
  • om cea mai creativă? magnific :)
  • guest_158 Unicox :D el oh e l
  • haszart shii cu cantecul asta????
  • andrew asta la codru treb dusa...
  • offff alice in tzara eurovisionului)))
  • Vero Shiny 80s dresses - I knew girls who wore dresses like that to my high school prom in 1987
  • lalala engleza participantilor cam zgirie
  • guest nu neponeatno je:)))
  • guest_148 fu fu fu
  • ghita Rusine la Juriu. Pe cine au ales.
  • Irina ma simt ca la matineu la gradinita, cu un fel de regizare stangace
  • guest_166 astia sitn muzicieni profi-tre sa mearga la concurs jezz, eurovision nu e pentru asa ceva
  • me :))))
  • omg my eyes are bleeding ヽ(≧Д≦)ノ
  • WTF ceeee-i aia
  • guest I like very much this Transbalkanian group, but they singers are veryyyy week!!!
  • true bred
  • aliosha in drum spre casa de nebuni
  • arji oribil de tot
  • liubo4ka Univox e bun, dar nu e in format
  • zayka ea...romashka atdihaet
  • mikutza nu imi place piesa deloc ..si e nepotrivita pentru eurovision..nici o sansa..
  • l.a.-m.m. si gradiita este asta
  • A oi proaste
  • Bloodvik astea vreu po ervopeski :d
  • ivanturbinca nish drashii din iaz nui primesc sa le cinte :D
  • Miha noru cela din spate sufla aer din fund :D
  • guest_122 o ffuuuumat mult aistea
  • limon asa ca 2 persoane sunt care mi-au atras atentia..
  • . lea lea
  • urski la codru mai sunt locuri??? votati-o pe nr 112 :D
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • guest_10 rap
  • offff ooooo hip hop.....
  • guest_159 mudi mudi
  • gri original
  • FILAT tara n-are presedinte dar voi va zghihuiti pe scena
  • kyoko sii cu dibilu ista
  • euuu cum au ajuns aici
  • Cristina shii cu asta??? :)))))))))))))))))
  • Cristinuta mudi mudi... lol... e amuzant sa-i vezi la eurovision
  • buburuza vreau si eu sa fumez, ce au fumat ei !!!!
  • j imi vine si mi e sa zic acum in rusa : ohre..eti
  • guest_88 cine ii va vota tot cu mintea la gradinita
  • euro soare raper
  • guest_94 Doamne fereste
  • ,,,,,, Fuuuuuuuuuu
  • lol,,:) mde...
  • Metrun rap
  • B nau sanse
  • guest_98 nr 10
  • kukurigu ujasssssss
  • shoimarel plinji costiujeniu dupa dinsii
  • El Commander hahahahahahahahahhahahahaaa :D
  • Lesika OMG parca is cazuti in patrujel
  • FILAT parca is drogati
  • arji durdom ramasca
  • aliosha ea are chiloti turbati :D
  • Analqueen i cant fap to this
  • je so abcurit sau shi asta?
  • Tatiana Doamne ferește
  • andreea cine vrea sa facem cunoshtintza ? :D
  • guest_122 aistea rup mintea
  • guest_159 ciuvacu trebuie sa aiba o frunza de canepa in loc de soare
  • j la prinkidel poate e si bine
  • WTF Psd de unde o mai venit shi ashtia
  • guest_160 super
  • Dragon aista tipa răpcik :))))
  • om I'm getting high and high :) Aţi trecut prin green room? :)
  • guest_94 Buburuza + 1
  • TZUTZA parca is retardati
  • Iurcel Ce drucuuu
  • shoimarel aishi mai trebu pavel turcu sa danseze si cintecu e super :))
  • mudi mudi ce inseamna mudi mudi
  • guest_132 futetio nahui ku aliantele voastre saturati lumea
  • coco chanel e desculta
  • lilia ce coregrafie au.... sa-mi bag piciorul...
  • sms alice in marijuanaland
  • hhgj levaaaaaaaaaaaaaaaaaa
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • nicu parcă-s de la casa de nebuni!!!
  • - Finala concursului Eurovision 2012. Selecţia Naţională. Retransmisiune de pe Moldova1
  • elena de cu asta aici cu soare
  • mda muli muli
  • Victor Limon ..pe nimeni nu fute ce scrii tu...asa ca te rog inchideti HUINEAUA
  • guest_86 jioooooooooos
  • ivanturbinca floricika
  • guest i-o tremurat vocea ))
  • f_89 parcas cu chupa chupsuri in mina :D
  • guest_20 a lea Bjork
  • ,,,,,, huuuuuuuu so terminat
  • Iurcel Costujeni
  • marina super bnicoleta gavrilita
  • mandarin al citea cintec este
  • guest_133 Acord .... ian sa vedem
  • Miha mallul- epic ...
  • offff asadar aceasta a fost echipa Albinutza,,,urmeaza echipa Floricica)))
  • guest_50 llllllll
  • kyoko oo iata si akord
  • true hai la mall
  • lkl why singing in english if u have ur own language?
  • guest_10 hai la mall
  • ha oooooooo da
  • guest_160 o shiobanii
  • kuku haha,,ban?
  • Olga oooo pe dinsii ii asteptam
  • Soarele oare kiar nu avem talente in md?
  • guest_205 Akord ia sa vedem
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • j inca 2 20 Akord „Live The Show” 21 INAYA “Lights”
  • steopa jios aliansu
  • Metrun Ai ghimpa si tei indragostiit
  • ivanturbinca true da cei la mall?
  • ........ amus o sa vedem ce muza :D
  • urski iaca acus slagar maldavenesc
  • marusha m studio the best
  • limon Stimati comentatori..acesta nu e site de socializare..ci doar de afisare a parerilor
  • FILAT jos alianta
  • dony frumos akord bv
  • mandarin mersi
  • guest_10 hirtie igienica
  • A oi proaste
  • daf lkl u jelly?
  • shoimarel o murit muza
  • kuku mîncare
  • marcik ce inseamna djăi bai djăi? ce limba e asta?
  • zayka au o voce puternica
  • guest_32 domane , sa ma impusc nu alta, cu asa melodii pe aici
  • om m-am trezit dimineata si rast o piesa :) off
  • euuu si piesa aceasta nu intrase in finala cum de a intrat Taranu?
  • offff Djai bai djai we rock))) djai bai djai we rock,...were are we going tjodai)))
  • M not sure if muza or just a fart
  • euro blea so vopsit si ei
  • medvedev vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • guest_160 votati ca au mergele
  • guest_160 votati ca au mergele
  • Metrun aistai ultimu
  • Vero amush le sare si lor microfonu, ca marianei mihaila
  • medvedev vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • ion o boje
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • :)) djay bai djay
  • eu_eu nu inteleg, unde treb de scris pe facebook?
  • Analqueen me no jelly ia tvoiu trubu shatal
  • guest_253 zi cu zi
  • medvedev vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • aliosha ce e cu shourile estea ieftine la oamenii eshteaaaaa
  • mar unde se pornesc ???)))
  • M1 kak abi4na nu s nishka
  • buburuza hartie de WC?
  • true amush o s inkedishi de lentele shelya
  • nietzsche vaz )))))))))))))))))
  • M1 makar din picior s dee
  • Put in si inca n-ati ales presedinte?
  • alex l-au plagiat pe pasa parfeni de anul trecut la show
  • X-Pedro Da da si mie mi-o placut cum cint transbalkanica
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • mandarin m-au dat gata toti unul mai slabut ca altul
  • steopa eu cred ca in loc ca tatz aishtea sa se skreme aishi in fata la atita lume mai ghine s-ar dushe ku rindu
  • M nu "live" , ci "leave" )))))cat mai rebdi priciom
  • andreea lemon : imi zici si mie ce ai de comentat aici sau la piesa precedenta ?
  • limon Victor..cum sa nu ii intereseze ce scriu eu..daca tu si inca un utilizator imi puneti intrebari..asa mai "delicate"
  • Vero show de dat peste microfon cu lenta :D :D :D
  • aliosha numa mie imi amintesc lentele astea de hirtie igienica?
  • guest_58 acest eurovision trebuie sa intre in istorie
  • Iaka multumesc medvedev
  • medvedev vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • pidarilor sugeti pula! normal)
  • doremi din ce an e vaz-ul ? ))))))
  • Sarkozy Traiasca Tranbalkanika, Chimpu si Voronin au gusturi bune Sarkoszy e cu VOi
  • ion caut gazda la ciocana
  • guest_159 nus de Akord ca ei sa mearga
  • guest pentru ce shkatureala pe fatsa shi margele la git la barbat?????
  • mandarin si ei mai doresc la eurovision
  • pidarilor sugeti pula! normal
  • guest_200 vind teren cel putin 20000 euro
  • dony ku kit lada?
  • mudi mudi plashi cu paiete!! kapetz!
  • Iaka vand hartie igienica, pret negociabil! :)
  • olika si cu cit o vinzi?
  • guest_40 live the show ! :)
  • Lesika ujas:D
  • daf aliosha da mai shtii:DD
  • medvedev 1999 e foarte buna
  • guest_86 ))))))))
  • shoimarel sa mearga vazu
  • buburuza cos ciorapi de lana !!! reduceri finale !!!
  • guest_98 Acord sa mearga!
  • guest_62 2 boi ragg
  • Daniel Agger E tareee nene.....)))
  • ion nu iak de ce Nelly Ciobanu s-a retras.....din cauza asta io pus pe astia
  • ha dar eu caut un serviciu
  • andreea alegem preshedintele dupa eurovision , doar ca nushtiu anul exact ...
  • steopa fete frumoase 350-400 lei ora, depinde de rezistenta
  • guest_122 uscata oiesa
  • gHIMPU HUIMPU DUSETIVA NAHUI DE AISI dusetiva nahui ku aliantele voastre de aici
  • omg valeu urechile
  • marusha fuu akord
  • liubo4ka mesaj indirect pt cei din sala: leave the show :))))))))))))
  • derp vind pocika in stare buna, singurul proprietar
  • anka dau volumul mai incet si parca zbiaramai tare:)))
  • mandarin da publicitate
  • limon Draga andreea nu am ce comenta la asa piesa..nu imi place si atit
  • doremi da de ce o vinzi daca e fff buna?
  • ivanturbinca unde e acela cu eurovision lume multa lume buna? :D
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • ZZZ ofer job : 400 $/luna
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • ion eu caut baiet :))
  • Cristinuta astia se accepta
  • steopa fete frumoase 350-400 lei ora 069200923
  • pidarilor sugeti pula! tu suca esti jitzica
  • irinaa loibo4ka
  • guest_61 de ce lasati asa comentarii murdare? stiti doar sa judecati
  • coco chanel ia si jitezl ii acel cu p**a
  • irinaa +1
  • guest_122 rau de tot
  • Irina mie imi place coregrafia
  • Victor Noi nu iti punem intrebari...noi pur simplu dorim sa vedem cit esti de prost)?
  • ion traiasca homosexualii
  • medvedev vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • Vero I'm beginning to think that Moldova is just a country full of eccentric artists who do whatever they want.
  • anka inaya e buna?
  • j ura vine ultimul pe azi!
  • X-Pedro ZZZ- teai abcurit cumva ?:)
  • ghita Unicul cintec care imi place
  • eyy are mustatza
  • sms noi in clasa 5 la matineu am facut danas modern” cu asa efecte
  • guest_33 bateie de joc nu cintece. Juriul tre de alungat.... plea mult cumatrism. din 21 de citnece doar vreo 2 au avut in general dreptul sa concureze, iar sa cistige nici una. suntem prea verzi pentru un show bun
  • ZZZ care cauta baiet: sunt 2 cu margele pe scena :))
  • olika cit e vazul mai
  • Engelhart varianta initiala a celor d la acord ara cu muuult mai buna!
  • ion steopa, poate mai mult, mai negociem, nu?
  • PUTIN Medvedev dute la kulkare
  • sweety ooo,inaya SUPER!!!!!!!!!!
  • euro crede ca-i krutaia
  • derp o ast lucreaza bine la aparat
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • aliosha salut, sint NNaia :D
  • Johnson Votati Cristina Croitoru!!!
  • kyoko aceasta cinei???????????
  • Daniel Agger oooo e buna de tot
  • Iaka hai canta
  • shoimarel pacat ca pe chat sunt multi ciobani.n-am stiut ca la stina au net!
  • pidarilor sugeti pula! we gandoni va plase pula???
  • guest_58 ujas
  • TZUTZA of si-i strasnika
  • buburuza masaj-erotic 079*******
  • andreea somebodyyyyyyyyyyyyyyyyyy
  • j chiar daca cantau aiuerea - instrumentalisti super => transbalkanika
  • coco chanel tipa: sinibag...:D:D
  • Elena plictisitor
  • Jorik se fignea cinta
  • andreea credeam ca doar asta va canta
  • steopa metode de prelungire a erectiei URGENT
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • alex somabareeeeeeeeeee
  • guest era dragutsa cu putsin machiaj.. au uritsit-o de tot!
  • sunt eu da mie imi place cintecu
  • Vero ne ducem la ungheni si vorbim cu pavel turcu, inca totul s'poate de salvat =)
  • aliosha asta back`u asa a detonat? (facepalm)
  • M dumnedzaule, cine sunt stilistii?
  • obama putin ce te-i ahuit?
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • VLADIMIR VORONIN ce pomeniti de mine
  • ha da foarte strasnica
  • lk chiar stranik
  • derp si parc nis nui din moldova
  • lynka vocea buna
  • ghita InaYa - imi place melodia
  • Iaka hai canta
  • anka mai bine anulau eurovisionul anu asta :))))))
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • andreea cui ii este a manca ?
  • PUTIN kinta marusea,kinta...
  • VLADIMIR VORONIN eu nu sustin pe nimeni
  • ZZZ ultima? :)) unde sunt melodiile? eu am vazut doar 2-3 acceptabile :))
  • limon cred ca stai in pik mai rau cu l.romana..de nu poti faci diferente dintre "intrebare" si "afirmatie"
  • ion vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • mau ce numar e ?
  • andreea mie pofta de rasarita
  • M daca ne poluati fonic, macar nu ne orbiti...
  • guest_10 bun
  • jorik da
  • mda shoimarel>>> wifi is everywhere :)))) da-i crezare
  • guest_160 da ursu ce o facut in butca ?
  • guest_13 where is button "Next"
  • urski viva pavel turcu
  • ha putin fals dar asa mergem la Bacu
  • guest_33 nu mult s-a destantat de steaua Pavel Turcu ...
  • irka somebody, somebody, somebody shut her up
  • cint si eu faina piesa
  • guest_20 merge
  • VLAD FILAT o sustin pe nicoleta gavrilita
  • daf super!
  • bu concluzia mea ca cei mai buni sunt: Dara, Transbalkanika si oleaca Gavrilita...eu votez Dara
  • alinuta333 dar este tare rau
  • Vero ne ducem la ungheni si vorbim cu pavel turcu, inca totul s'poate de salvat =)
  • haszart sunetul ii calitate "superioara"
  • olika cit vrei pe vaz 2109?????????
  • Lesika coreografie lasa de dorit
  • Ruslik_06 Transbalkanika!!!!!!!!!!!!
  • jorik si ce e deosebit?
  • j e ultima 21
  • angela jos alianta
  • irka_12345 somebody, somebody, somebody shut her up
  • mau vazele se vind pe 999.md nu aici
  • guest_210 E bunicica piesa
  • haszart am impresia ca canta prin skype
  • LUPU da de mine ce ati uitat
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • MIHAI GHIMPU eu o sustin pe nicoleta gavrilita
  • shoimarel ion ti-ai luat vazul si ai fugit la stina!
  • vv imi place mandinga kare va reprezenta Romania..... voi ce parere aveti?
  • buburuza cumpar partid oligarhcuputzamica@gmail.com
  • guest varianta radio e mai buna
  • guest_40 Sasha Bognibov.. hai vina cu trolebuzu tau k vad k aisi tat ii pre niska...
  • marcik fata asta m-a surprins, e chiar deosebita
  • ha jos angela
  • Elena Fiecare are dreptul la replica ,Fie cioban timplar sau alta functie ,,da nu putem obri mesajele ce nu consin comentari la tema data ..asta e
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • guest_205 din toti zik ca merita pasa parfenii sau dara
  • shoimarel shi poti sa o iei si pe angela cu tine!
  • j angela - parca ai fi divol da nu inger
  • ion si eu vrau vaz
  • lokryd unde de votat pe net?
  • PUTIN hai spune bre kit vrei pe deveatka?
  • ivanturbinca de acord vero
  • mikutza votez..Dara..
  • guest_32 e obosita si asta
  • Topo Adresa concreta lui Turcu va rog!!!
  • j aici se vorbestte de eurovosion
  • aliosha Himpu are razdvoenie lich`nosti :F
  • guest_159 Verisoara o sa cistige :)
  • zoia jios aliansu
  • alinuta333 vind mercedes e class 2005
  • guest_17 To Moldova
  • TZUTZA intersant cine sunt stilistii de la eurovision..
  • Iaka vand partid cu Lupi
  • pidarilor sugeti pula! vind gandoane!!!! super oferta
  • phillo ea imi palce cum cinta.... dar eu ash fi facut un show mult mai bun in spatele ei....
  • MARIAN LUPU eu o sustin pe nicoleta gvrilita si vad ca sintem si noi o data de acord ca nicoleta gavrilita merita sa cistige
  • mda hai deja daca v-ati adunat, "ghimpu","voronin","filat"...unde-i lupu??))
  • Daniel Agger Park vad ca iar se duce Geta Burlacu :D:D:D
  • guest_86 urechili meliiiiiiii!!!!
  • derp patzani, am probleme cu vecinii ce sa fac?((
  • j zoia - de zoae?
  • aliosha nu i-a mers cu back`u deloc, sarmana fata
  • Soarele nu aveti lighean de nerjaveika?????
  • andreea guest_205 aveti nishte gusturi ft bune , daca nu bune atunci compatibile cu ale mele
  • lenna votati dara
  • kuku ban!
  • Ruslik_06 eu cred ca totusi va cistiga Transbalkanika
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • anka terminati cu politica
  • guest_100 pidarilor sugeti pula ...sti ca IP tau se poate afla ...si daca vine politia la tine acasa...ce faci?
  • guest_56 800 euro...stiu ka nu se vinde aici,insa am nevoie mare de bani...e in stare oarte buna,diskuri titanovii,kraska radnaia......vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • ivanturbinca vind bugatti
  • guest_210 numai nu Geta
  • MARIAN LUPU uitel
  • varonin da unde lati pierdut pe filat
  • alina klasnaia ))
  • 05 ea cinta bine :D
  • pidarilor sugeti pula! terminati cu politica
  • GHIMPU Joooooooooos plea totzi! bichez!
  • varonin da eu ca filat
  • 05 ddd
  • euro si s-o terminat
  • Daniel Agger numa nu geta
  • zoia totzi interpretzii
  • guest_10 eu votez 21
  • guest_32 ce-i cu concursul asta
  • PAVEL TURCU opa... da de mine au uitat :((
  • guest_205 !!
  • lenna unica melodie superba Open your eyes- Dara
  • j gata concursul acum votam? eu aleg ce pot alege din ce este -transbalcanica
  • mda da,chiar terminati-o)
  • Iaka Hai la vot, juriul va decide ;)
  • Miha vand otrava :D :D
  • katy sunteti super, toti meritati sa mergeti toti la Baku
  • PUTIN eee...ku 800 de evro eu le vind tot AVTOVAZUL
  • guest_32 toata lumea e obosita sau televisiunea poate tranmite asa prost
  • guest_33 daca anul trecut a fost un singur canditat ca Pavel Turcu cu imnul eurovision, anul acesta is ca vreo 19.... Votati Pavel Turcu
  • zoia terminatzi ku politika mai, jios aliansu
  • euro eu n-as trimikte pe nimeni la baku
  • lokryd unde votez pe net??
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • guest_122 pe toti in p...la
  • buburuza kraska radnaya ))))))
  • aliosha pfffff
  • Lesika a zis ca sa cistigam:D
  • jorik Pe pashka la Eurovision
  • pidarilor sugeti pula! filat o fost futut de mititel \, asta si lamureste c amu suge la patani tat timpu))
  • sms i-aș trimite pe toți unde? please....
  • urski buuune blonde :d
  • remi eu tot votez ultima piesa
  • guest_86 Wai, daca voi castigati eurovizionu, ap eu vi-l organizez waaaaaaii!
  • ivanturbinca votam dara,asai bratani?
  • zoia jios aliansu
  • Daniel Agger Votati Dara
  • angelica jos alianta!!!!
  • guest_32 si eu nu as trimite pe nimeni
  • misha shii buna evelina asta
  • LUPU votati transbalcanika!!! ii sustine tot parlamentul. ei au fost cei mai tari
  • Cristina) votati M-Studio
  • phillo evelinaaa ????? :O :O :O :O haahaha.... cum degradeaza tzara noastra :(
  • mikutza votati Dara..numarul 18..
  • qqqqqqq VAND NEVASTA!!! AN FABRICATIE: 1983, Al doilea proprietar, certificat in regula, productie autohtona CULOARE: roscata, DOTARI: suspensii super, portbagaj mare, faruri bleu-ciel, grila radiator rosie bombata,2 air bag-uri frontale excelente, STARE FUNCTIONARE: f. buna, putin uzata (cam de 2 ori pe saptamana; da’ duce mult mai mult) CAI PUTERE: ooh my God !!! ( poa’ sa tina o herghelie) STARE CAROSERIE: putin atinsa – a fost un mic accident cu un vecin care nu s-a asigurat (daca sunt sau nu sunt acasa) si a intrat in ea; in urma accidentului el a fost grav avariat, iar ea a suferit doar niste atingeri de curea pe aripa stanga spate, dar cu timpul se repara. PRET: negociabil, O dau cu tot cu accesorii: unu de 3 ani si unu de 5 ani. Rog seriozitate….
  • guest_32 asa vrea sa "caslige"
  • mmm azi m am distrat de minune....ca la circ ..zau
  • guest_210 ultima piesa super
  • A oi proaste
  • VLAD FILAT poarta o vorbire decenta
  • zoia votati masa-n kur
  • ha bai ghimpule parca teai pus in priza fix ca vorosca jos alianta jos alianta
  • Iaka votati aie!
  • A oi proaste
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • ivanturbinca eu o votez pe Dara pentru presedinte :D
  • A oi proaste
  • euro zadalbali cu da5ra sta ce cu voi?
  • katy sunteti super, toti meritati sa mergetila Baku
  • klmn cum pot sa aflu adresa dupa IP
  • lokryd unde votez pe net?
  • lokryd unde votez pe net?
  • guest_10 slab,foarte slab!!!
  • lokryd unde votez pe net?
  • lokryd unde votez pe net?
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • zoia cine e candidatul aie?
  • Soarele bei da kiar tranbalcanianca nu a mai facut fata
  • Dina pe net nu se voteaza
  • buburuza nu am ras asa de mult timp ))))))))))))))))) merci chatului privesc.eu ))))
  • ion corekt zici...manelism muult
  • shoimarel atita cultura pe chat-ul asta !!
  • katy dara esti super
  • Soarele numai reklama si nimik mai mult
  • asd123 luatiasi falca-n pula
  • A oi proaste
  • offff asadar sa va fie clar milism = manelism))))
  • angelica John Onoje e candidatul AIE
  • A hai sa le trimitem da nu la Baku
  • zoia cine e candidatul aie?
  • zoia Cine e cdidatul aie
  • guest_132 va vede toata lumea cum vorbiti aici rusine
  • Milania paralelaaaaaaaaaaaaaaaaa,unde sunt toti?????????
  • zoia cine e candidatul aie
  • VLAD FILAT eu
  • Lesika A: turma
  • zoia cine e candidatul aie
  • lol,,:) axaxaxaxax
  • ion da vorbitzi mai frumos....ini inkipui ka voi o sa kintatzi mai bine
  • zoia cine e candidatul aie
  • bu nu votezi pe net, votezi prin telefon
  • MetaN Pasha Parfeni The Best
  • guest_122 le trimitem in turcia
  • VLAD FILAT eu
  • aliosha so nakurit sh o kreat
  • guest_81 tres sal comandam pe justin bieber pt eurovision
  • Fat-Frumos din Parlament frumos aici unii cinta
  • Iaka Toti la vot, votati AIE, jos comunistii!
  • cucu invata lb.romana..:D
  • euro asta-i parca din puscarie
  • andreea creati lumea voastra acasa ...
  • guest_100 zoia .Adrian Ursu
  • kuku el
  • buburuza i swe vede sutienul )))))
  • kalin777 pt dara
  • Soarele kiar nus in moldova talente?
  • zoia cine e candidatul aie?
  • GHIMPU vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • zoia cine e candidatul aie?
  • turku boilor ce sunteti, lasati politica
  • Lesika :d:d:d
  • angelica jos aie
  • zoia cine e candidatul aie?
  • zoia jios aliansu
  • zoia jios aliansu
  • marioara unnde pot sa gasesk rosii proaspete??? la piata sint zbircite
  • om they are high :)
  • ivanturbinca dara zoia..dara
  • cucu parca-i zac..:D
  • WTF Pasha Parfeny sooper
  • kuku zoie,,,hară
  • zoia turku shhh
  • katy dativa seama cum vorbiti
  • angelica am zis ca John Onoje e candidatul, surse proprii
  • porsche corina fusu
  • VLAD FILAT eu eu eu
  • ew da da pe cine lau pus ca candidat AIE la eurovision
  • kalin777 Daraaaaaaaaaaa
  • Fat-Frumos din Parlament parca-i penis)'
  • guest_159 uuuuuujaaas
  • GHIMPU moldova fara rusi e ca moldova fara comunisti, vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • guest_174 fuuu univox
  • ghgh ujaaaas
  • 123asd la ma-ta in beci
  • offff anjelika varum)))
  • mikutza Nicoleta Dara...
  • :)) -1 pentru show'ul ratat de azi... +100500 pentru chatul de pe privesc.eu ...nu am ras niciodata asa
  • S ion : nu e vorba ca vom putea cinta mai bine , e ideea ca daca nu poti cinta , lasa aerile de mari specialisti ,si mai bine te retragi , decit asa rusine
  • euro da-o nafig pe dara
  • zoia ei shtiu eu is porasta sh nu shtiu
  • sms nu cheltuiti banii de pe telefoane!
  • Hi! Dara parca a cantat mai bine si nu e o melodie chinuita, ce parere aveti?
  • viktor imi stroc doar dispozitia cu tota nebunia asta
  • A fuuuuuu
  • turku tormoji
  • limon ha..a disparit Victor..reflectezi la ceea ce ti-am zis eu se vede..sau faci lectii de l.romana
  • mau da kit kosta un sms sa votezi vriun moldovan ?))))))
  • A oi proaste
  • guest andreea tu esti proasta?
  • A fuuuuu
  • zoia dara, fu no sankapa in avion, in baku is mai alesh
  • kyoko mii rusine de ei
  • buburuza multumesc privesc.eu... nu am ras asa niciodata !!!!! )))))))))))))))))))))
  • mikutza cit costa un vot?
  • oana dara e asha sweet :) cum au cantat tarasiuc cu gutza? :)) da parfeny?
  • angelica andreea, ce absorbante folosesti?
  • guest_62 ce au toti ochii negri?
  • GHIMPU moldova fara rusi e ca moldova fara comunisti, vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • Iaka Vand primul loc la Eurovision 2012!
  • angelica is mai bune Molped sau Cotex?
  • shoimarel indiferent pentru cine ati vota orange cistiga :)
  • jorik Internetu isi baga pula da nu va iubeste, de unde scoate dalbaiobu ista cuvintele astea?
  • eyy accent pe fingale
  • olguta27 8 lei costa
  • A iaka niste patani de treba
  • gheorghe cum credeti kare este cea mai buna metoda contraceptionala?
  • porsche afara gomisii
  • Vasea Interpretii necunoscuti au cantat mai bine ca cei "consacrati":)
  • guest_32 :d
  • katy guest_174 ai dreptate
  • limon andreea degradeaza un pik..dar nu-i oferim atentie ..nu mmerita
  • kyoko parcas narkomani
  • euro molped
  • Don Pedro ma scuzati, da eu ma duc s ma berberesc la ou c manghimpa dam
  • guest angelica shi andreea vorbitsi in privat, sintetsi 2 proaste
  • GHIMPU sheeeeeeeeeeeeeeet
  • ha da ce vrei sa le gusti
  • Hohloff а чего тут показывают?
  • lol orala
  • oana akord atata scandal a facut si s-a aninat de toti,numai ca sa ajunga sa zbiere pe scena si sa ne face de rusine
  • offff o seara emotionata...votati akord...jios alianta)))))
  • buburuza vrem castrare fizica !!!
  • ZZZ akord sunt najpa de tot
  • euro ma duc si eu sama fac got
  • eyy vind demachiant pt Acord
  • A oaie proasta
  • andreea nu-s proasta is fericita , am retrait zilele astea mai mult pentru asta decat pentru eurovision !!!!!!!!!!!!!!!!!!!!!!
  • GHIMPU suuuuuuuuuuuks
  • guest da Anatolie nu se baga prea tare in sufletul concurentilor?
  • A da eu despre ce spuneam sunt proaste
  • guest_32 Don Pedro.. esti nebun..:D
  • Puff Pentru o ultimă impresie ... Si chiar se merită!!! http://www.youtube.com/watch?v=oFm0ApksBRw
  • andreea si angelica folosesc always dar tu ?)))))))))))))
  • olguta27 cit trebuie sa mai asteptam rezultatele?
  • alinuta333 un statut draga nu status inaya
  • Don Pedro da tu esti romanca proasta
  • ivanturbinca anatolie parq se afla la x te iubeste
  • guest si asta e un bun argument pentru a-l scrie pe chat? pentru totsi????
  • klmn ce-i cu miorlaita aceasta?
  • TZUTZA blonda si cu sprancene negre , offffffff
  • Cristinuta e frumusica
  • gheorghe vind vaz 2109 in stare foarte buna...mai multe informatii la nr. 068904197
  • angelica eu pun bint cu vata
  • ivanturbinca anatol parq se afla la x te i beste
  • GHIMPU moldova fara rusi e ca moldova fara comunisti, vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • Lesika are emotii ceredeti :D
  • buburuza vreau sex in 3 ! :P
  • limon Andreea "a retrai" inseamna a trai niste momente pe care le-ai mai trait odata..
  • Don Pedro dauy de futut
  • Don Pedro cn vre sunati
  • A nu votati, nu fiti prosti
  • guest_134 of...impuskatil
  • guest_32 Don Pedro.. defapt sunt moldovanca, si nu e frumos sa spui in public ca te inghimpa la oua, in cur nu te inghimpa..?
  • oana WTF/???????????!!!!!!!!
  • Don Pedro nr mob 067777392
  • oana votati dara va rog o sa ne face de rusine ursu :((((((
  • guest_249 pasha))))
  • guest_148 rahat
  • ghita Eurovision pentru noi nu exista. este doar BADVISION
  • offff iak asha:))))
  • Estan wtf???
  • ivanturbinca daaaaaaaarrrrrrrraaaaaaaaaa
  • guest cristina va cistiga televotingul...deacum depinde de raspunsul juriului ))
  • ion dupa eurovision facem sex in 10, numai ca fara andreea, ea are menstruatie
  • eu www.isondaje.ro/sondaj/250449196/
  • Iaka "Votati, votati is iar votati" A.I.E
  • jorik Votam pe Ghimpu la Eurovision
  • A nu votati pe nimeni
  • jorj pasha dawai
  • turku timpiti
  • pingus buburuza si eu ))))
  • limon woouu..in comentarii sun afisate si nr. de mobil..
  • ghgh macar bine ca nu ursu
  • eu sondaj www.isondaje.ro/sondaj/250449196/
  • aliosha ooooo
  • guest_32 scena nu a fost pregatita deloc, toti cantaretii au fost imbracati parca cu haine din secolul trecut , de voci nu mai zic, rusine
  • A nu fiti prosti nu votati
  • euuu korona nu degeaba a bagat banii
  • sms hai davai
  • YoshimiTsu cum de votat online ??? parka au spus ka se poate? nime nu shtie?
  • Alina imi place cum canta DARA
  • andreea vata cu bint ????????? ma apuc de cusut atunci ... mai econoomisesc ceva bani ca sa-i votez pe astea
  • vv anatol aista s-o mai insurat? ka ceva vazusem cum i-a fakut cerere in casatorie iubitei lui...
  • buburuza sex in 10 )))))
  • omfg pasha ....go go go
  • Cristinuta 1 e groaznic
  • kit exista doar cumatrievision
  • oana ooohooo tsaranu :D
  • eu www.isondaje.ro/sondaj/250449196/
  • Cristinuta 2 e ok
  • kira S-o insurat! Deam si bebe asteapta!
  • ARGI euuu tu spui adevarul aici miroase a bani
  • vvvvvvvvv llllllllll
  • buburuza evrohueta
  • Cristinuta 3 nu e rau
  • urski tati cantaretii de la gumanitarca o fost imbracati
  • eu www.isondaje.ro/sondaj/250449196/
  • ivanturbinca buburuza dac imi spui cite puncte ai pe spate iti dau o banana :D
  • A nu votati,ka parlamentarii nostri, nu votati, decit pe cine nimeresti, mai bine nu votati
  • alinuta333 da vestimentatia este tare
  • aliosha manciu parca s-o pornit la primblare cu sobacika in park
  • Miha Jos Alianța
  • Cristinuta 4 nu e rau
  • sms manciu sucks
  • :)) cei de la Orange isi rup parul de la cur ... showul e circ adevarat
  • Cristinuta 5 e aiurea
  • Alina Da Manciu ce cauta pe aici??
  • eu nimeni nu mia plakut ..da dak de ales ap dara sau paralela 47
  • ha mai sasuli manciu mai maninca maliga
  • Vero da cind s-a dezbracat ALECU?
  • Tina Alexabdru Manciu the best!
  • ngelish Cristinuta ai gusturi rele, foarte
  • adrian ursu votatima ca eu is cel mai bun
  • guest_100 uite mintea comunistului ... NU VOTA :))
  • jorik hai ma repede sa se termine ca vreau sa ma chish,
  • jorj pasha dai bataie
  • Cristinuta 6 nu chiar
  • WTF Cine Cishtiga Premer League?
  • oana prea multi clovni anu asta:))
  • euro nu vreu croitiru sa cistige
  • TZUTZA jorik , eu tot!!!!!!
  • guest dara!
  • vv mersi Kira.... nu am stiut ka si nunta a facut... a prins la burtika un pik :)
  • Cristinuta 7 asa si-asa
  • GHIMPU moldova fara rusi e ca moldova fara comunisti, vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • jorj pasha foc la ghete
  • A oi proaste
  • A oi proaste
  • guest_205 www.isondaje.ro/sondaj/250449196/
  • A oi proaste
  • Cristina) lume votam M-studio sau paralela 47
  • guest_62 nr.7 parca e vampir
  • aliosha sii ragusita croitoru
  • ngelish paralela sau gulko as vrea sa plece...ei sau na hudoi konetz croitoru
  • eu www.isondaje.ro/sondaj/250449196/
  • Ingeras Votatil pe pasha!
  • Ger_rarD Liverpool
  • Cristinuta 8 nu-mi place
  • Doru` pleee am impresia k` nime` nare un cintec demn de eurovision..
  • Cristinuta 9 nu e rau
  • kira asa-s barbatzii dupa ce se insoara :)
  • omfg kristina slab
  • eyy vvmersi Kira.... nu am stiut ka si nunta a facut... a prins la burtika un pik dap sotia va naste , nu el
  • eu votam croitoru!!!!
  • eu rezultatele is aici www.isondaje.ro/res/25044919637777/
  • limon piesa Marianei mihaile are un nivel jos
  • varonin acord locul 1
  • WTF Liverpool Harosh
  • ivanturbinca cine recomanda un film de nota 10?ceva motivational
  • buburuza buburuzele voteaza cu Pavel Turcu !
  • Lucho cind s-a dezbracat ALECU? asta m-am intrebat shi eu
  • Cristinuta 10 nu-mi place
  • miki @ eu- de acord cu tine
  • aaaaa cristina croitoru....super
  • dht cristina croitoru a cintat frumos
  • omfg pasha ii tat
  • eu aici votati www.isondaje.ro/sondaj/250449196/
  • kriiis ujas,,,din 21 de cintece numai 3 reusite rusine!!!
  • TZUTZA ivanturbinca uite la untouchables , film francez
  • Cristinuta 11 nu-mi place
  • sms pasha parfeni bunișor cîntecul
  • Suarez Liverpool Fc Rooope tot
  • GHIMPU moldova fara rusi e ca moldova fara comunisti, vom vedea cine de la cine va suge, dar la moment sunt deacord cu VLADIMIR VORONIN, Transbalcanica - Balkan Riders The Best
  • Doru` ee
  • katy 11fu
  • eu aici is rezultatele www.isondaje.ro/res/25044919637777/
  • Ger_rarD WTF esti Daniel Agger? :))
  • Cristinuta nu e rau rau rau rau de tot
  • offff mai bine sa mearga gavrilitza
  • ghita azi a fost preselcetia la turcuvision.
  • oana geta vad k e destul d ok:)
  • parfeniipasha haters gonna hate !
  • euro votati numai acord celalalti sucks
  • A oaia proasta
  • Alina 12.. fuuuuuuuuu
  • om eu m-am decis, votez 11.
  • Suarez da
  • plinbarila fu gavrilita
  • Cristinuta sunt cateva cantece ok
  • Suarez amu suarez
  • jorik Jita Burlacu o ieshit? shine o dezlegato?
  • Jora croitoru dac se duce la eurovision sashi faca inalbirea dintilor...
  • ghita Felicitari pentru ei toti au trecut!!!
  • angela jos alianta
  • dht cei cu accentu lui ursuuu?
  • asd123 numa bishi
  • omfg ursu marsh in birlog
  • lol,,:) hopa hopaaaaaa
  • guest_243 Anatolie Melnic esti jalnic, du-te si te ascunde...
  • Doru` :d
  • kyoko Ursu inainte
  • vv deacord... treb sa se ingrijeaska si ei kiar daka se insoara,daka sotiile nu se ingrijesc barbatii repede le leapada, da noi asa ii iubim... ehhh,tu lu mama lor de barbati
  • lokryd welcome to md blea
  • Doru` v nature...jita...
  • Doru` ;d
  • Cristina) 15 ))
  • guest 15 nice
  • guest_145 angela mars la spalat veceul!
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • ivanturbinca Tzutza..l-am vazut...mai recomanda cineva un film bun?
  • sms adriancik be yourself, du-te si plimba ursul
  • ghita azi a fost preselcetia la TurcuVision, toti au trecut cu succes!!!
  • parfeniipasha M studio you suck hard
  • buburuza vreau sex in 3, imi trebuie 2 fete ! urjent
  • Doru` uniree!!
  • Suarez Liverpool Rooope tot restu huinea
  • parfeniipasha Dora bine
  • jorik2 dece asa dur jorik...incearca tu la noi in moldova sa faci ceva
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • victor ursulica dute si suge laba
  • dht anu asta e rau de tot la noi
  • guest_122 11 e super
  • plinbarila fara vibratie se cinta ca buranovii babuschi
  • coc chanel 17 au furat piesa
  • eu www.isondaje.ro/sondaj/250449196/
  • guest imbracamintea Transbalkanica lasa de dorit!
  • xiusha ei si s joaka dea shine a sa kinte mai rau ?
  • pavel turcu anu ista nu am avut concurenta deloc... luam 1 loc precis
  • sms trash
  • parfeniipasha da synops nu e in preselectie sau cum???
  • phillo shi daca participa Inna pentru MD?? cu curu' afara shi cu vocea ei de mitsa spinzurata cred ca toti doar aplauze shi cuvinte de lauda, nu??
  • guest_62 daraaaa
  • jorj priceom liverpool aici?))))))))))))))
  • Vero @ ivanturbinca Last night in NY
  • guest_148 tati de mina ducetiva
  • offff open your eyes nu supara auzul...
  • mikutza 18 merita sa cistige..votatio..
  • kyoko aistea vapse rup
  • katy dara esti cea mai buna
  • Cristinuta 19 a fost cel mai aiurea
  • jorik2 dara e buna fetita
  • ivanturbinca recomandati vreun film macar?
  • andreea desert flower ... e ft puternic filmul
  • Doru` .
  • TZUTZA eu cred ca shtiu pentru cine o sa votez.. pentru nimeni.iakasha
  • ARGI de la cine au furato,prostie ?
  • dht akord nui rau sau croitoru)
  • buburuza ivanturbinca_the artist
  • jorik ce inseamna cind oul sting te maninca?
  • aliosha The notebook- film bun
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • eeeeeeeeeeeeeeeeeeee Никогда не забуду тебя.
  • liubo4ka heart - Dara. Mind- Transbalcanica
  • Gicu dara super bafta
  • euro votati acord fuck others
  • jorj @ivan turbinca law abiding cityzen
  • guest_161 ivanturbinca,vezi the blind side
  • Don Pedro ma scuzati, numa am venit, am fost s mam ccat la viceu
  • kalin777 dara merita sa kistige
  • kyoko deacord cristinutza
  • xiusha dae bun filmu , da e tare serios
  • eu http://www.isondaje.ro/res/25044919637777/ aici is rezultatele
  • guest_122 imi placa gavrilita
  • katy Inaya super
  • eu www.isondaje.ro/sondaj/250449196/
  • sms n-as spune ca Last night in NY e din cele mai motivationale filme, dar e bun
  • parfeniipasha Don Pedro,acolo o fost mai interesant ca aici ashai?:D
  • yo Anatolie Melnic esti jalnic, du-te si te ascunde...
  • GHIMPU ivanturbinka, proveste filmul "comunistul"
  • WTF Racing Santander 0 - 2 Barcelona
  • Don Pedro atentie!!! dau de futut numa la fete!!! Baieti nici nu va ginditi!!!
  • guest_98 macar unu e destept (dht) altii is prosti
  • TZUTZA ivanturbinca the machinist ai vazut? rupe
  • guest_203 4
  • alina 21 trebuie sa cistige,cel mai normal pt eurovision
  • andreea don pedro poti sa pleci shi sa-l mananci , iti fac un rezumat la tot ce se intampla acolo pana vii tu
  • A votati amu votati
  • ghita kakavision. votati. orange face bani
  • om La mulţi ani!
  • necunoscut geta burlacu foarte rau
  • euro 654321stop
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • Moldcell sa mi-o suga orangiu :P
  • angela Don Pedro, daaaa? :)
  • aliosha ooo barcelona a cistigat!
  • A votati amu
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • guest_145 The Pursuit of Happyness
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • guest_62 futetooo
  • A votati amu
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • Spectator Am ratat ultimele prezentari...imi mkerge prost netul...Blestematul de Moldtelecom...
  • GHIMPU eu, filat, dodon, lupu si multstimatul vladimir voronin votam transbalcanica
  • euro blea publicitate
  • omfg Don Pedro....da di shi
  • A votati amu
  • :)) saracii oameni din sala...oare cat le'o dat numai sa terpeasca tat bredu de la acest show
  • lokryd the notebook ... e super
  • lol nui cinstit asa putin.... pe astia de pe ultimele pozitii nu a reusit multa lume sai voteze
  • A votati amu
  • mikutza Daraaaaaa..
  • parfeniipasha eii don pedro, chiar nici pe pasha parfenii nul primeshti?eh ty(
  • olguta27 au numarat de la 10 la 0 ca sa ia o mika pauza?:))) e frig acolo stau in scurte
  • A votati amu
  • M_S_I Pe cine votati?
  • kyoko iaka reklamile is mai prikolinie
  • bu caroci am impresia ca Vacuta Cristinuta o sa castige, dar nu merita are un cantec foarte ieftin
  • plinbarila aisia cinta gainile,nu trebuie turcuvision in moldova
  • aliosha lokryd tot aista l-am recomandat :)
  • olguta27 eu tot am net dela maxdsl, dar merge super
  • guest_161 lokryd,fain film :))
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • eu www.isondaje.ro/sondaj/250449196/ rezultatele http://www.isondaje.ro/res/25044919637777/
  • sms *happiness
  • Moldcell orange sucks
  • ivanturbinca lokryd lam vazut e tare
  • n jos geta burlacu
  • Don Pedro andreia nu vrei s ne intilnim?
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • sveta e euroision moldova sau toti?
  • lokryd remember me?
  • eyy la ghimpu zaela plastinka
  • Don Pedro nii ni se pare c nai fost udalitvarita demult
  • guest_161 ivanturbinca
  • ghgh noi de semifinala de la baku nu trecem
  • plinbarila va cistiga transbalkanica
  • katy bu parca citesti ginduri
  • guest_62 la anu eurovision va fi in suedia
  • guest_161 ivanturbinca,vezi The blind side sau my sassy girl (varianta americana)
  • mikutza oare cine o sa cistige/
  • guest_158 Moldped!
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • floarea ar fi mai bine sa cistige parfeny
  • Moldcell don pedro, esti F sau B?
  • Vicaaa Don Pedro hai ca vin eu
  • euro da reclam de molped e in moldova facuta sau e peste hotare?
  • plinbarila unu
  • me iaca si reclama: molped :)
  • Don Pedro blea da am un panos pzdc
  • guest glumele pot fi si de bun gust, doar ca aici unii nu-si dau seama.. Don Pedro, nimic cultura!
  • ivanturbinca ceva gen,,,oblasti timi?..recomanda cineva?
  • :)) bisnauru masii de reclama.....
  • lll cine ia prins pe paralele 47? cum au cintat?
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • Ariana Mie mi-a placut Parfenie,nu stiu dc :D
  • o parere gavrilita bravo
  • ARGI argi,lupu ghimpu si voronin sustinem transbalkanika
  • wisky pasha parfeni...go!
  • eu votati www.isondaje.ro/sondaj/250449196/ rezultatele http://www.isondaje.ro/res/25044919637777/
  • omfg el ii 2in 1....made in china(Don Pedro)
  • lokryd 6 demonov emili rouz
  • sms Drive, bun film (cu ryan gosling)
  • Vicaaa fuck this shit
  • guest_189 va cistiga cmatra111111111
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • Doar eu Gavrilita a fost buna, crazy :P
  • eeeeeeeeeeeeeeeeeeee Репортаж судьбы klassnii film
  • andreea don pedro vad ca sunteti analfabet , un nume nu il puteti scrie corect ... imi pare rau n-am placere sa ma intalnesc cu persoane cu un asha nivel de inteligenta ;)
  • Meleca Dara rupe tot
  • vind un par din cur huinea
  • ex Alexandru Manciu
  • jorik mi-o placut Pavel Turcu!!
  • mikutza Eu cred ca Dara are toate motivele sa cistige...e bravo!!!
  • guest_62 lu cui i sa facu a krapa
  • Moldcell Drive ++++ Ryan Costling
  • guest_145 Drive e bun
  • ich eu cred ca, Alecu Matraguna ar trebui sa stea la stiri. ATAT
  • Vicaaa shi breed
  • eu Dara e pe primul loc la moment www.isondaje.ro/sondaj/250449196/ rezultatele http://www.isondaje.ro/res/25044919637777/
  • LUPU Ghimplu blia, faceti liniste
  • guest_158 TYLOLHOT , parca au unit 3 cuvinte des utilizate pe net "ty" "lol" "hot"
  • prosaucontra cine cistiga?
  • olguta27 pe isondaje.ro, cistiga dara si parfeni, dar la noi in realitate nu va cistiga nici unul din ei macar ca-s buni!!!
  • vind un par din cur animala si esty
  • pt admin admin ce este cu chatul acesta?
  • Vicaaa Korona Zadalbala!
  • guest_24 Dara a fost cea mai originala!
  • vind un par din cur ce huinea
  • sms si muzica super buna in Drive
  • Don Pedro gluma de bun gust: so dus tandra la constanta ca sasi mai bronzeze fata, o venit tandra satula si de mare si de ..... soare. Alecsandri
  • vind un par din cur mam zaibit
  • vind un par din cur de shoul ista
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • o parere Acela nu-i Turcu acela-i Ursu
  • omfg pasha parfeny
  • guest_24 du-te shi te culca!
  • Moldcell eu am 21 cm :P
  • Ioana Acel cu pasarica pe ce loc este?
  • Transbalkanika eu
  • mikutza in cit timp o sa fie rezultatele?
  • ivanturbinca mai ales ca Dara cinta tot timpul live
  • jorik telefon cu buton Facebook, ce bred, mult aminte mai au merketologii de la orange, piydets
  • Transbalkanika eu
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • Vicaaa acel cu pasarica;D
  • Don Pedro moldcell la pula 21? numa??
  • guest_62 puullllaa
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • Mihaela cui ii ttreb cintarea la aishtea
  • eu cine cinta?
  • ha Transbalkanikaeu IoanaAcel cu pasarica pe ce loc este? Moldcelleu am 21 cm :P guest_24du-te shi te culca! omfgpasha parfeny o parereAcela nu-i Turcu acela-i Ursu GHIMPUeu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale vind un par din curde shoul ista vind un par din curmam zaibit Don Pedrogluma de bun gust: so dus tandra la constanta ca sasi mai bronzeze fata, o venit tandra satula si de mare si de ..... soare. Alecsandri smssi muzica super buna in Drive vind un par din curce huinea guest_24Dara a fost cea mai originala! VicaaaKorona Zadalbala! pt adminadmin ce este cu chatul acesta? vind un par din curanimala si esty
  • vind un par din cur si iara kinta?
  • vind un par din cur mam zaibit damu
  • ich acel cu pasarica e pe butonchic
  • juanitto Paralela :) Arde
  • Mihaela lasa sa spuna rezultatele
  • eu www.isondaje.ro/sondaj/250449196/ rezultatele http://www.isondaje.ro/res/25044919637777/
  • Cristina) bai Ghimpu si restu,..nu v'ati plictisit inca de mesajele voastre idioate?
  • eyy Alex Calancea Band
  • ew Don Pedro da ce tea apucat kikarea cind lai ascultat pe ursu sau pe parfenii?
  • Alina :) e frumoasa melodia
  • guest_148 fuegooooo
  • omfg Don Pedro: vrei mai mare?
  • Moldcell 21 cm, culcat :)))))))))))))))
  • :)) @jorik, ghini ca nu o facut cu buton Mne Nravitsea sau ku +5 de la odnoklsnk
  • GHIMPU eu, Filat, Dodon, Lupu si multstimatul VLADIMIR VORONIN am votat Transbalcanica , ii sustinem si la prezidentiale
  • Vicaaa alioo
  • Vicaaa synops va fi? cineva stie?
  • PUTIN Bai inka nu ne-am plictisit
  • aliosha cine a fc sex az?
  • andreea pedrooooooooooooooo nu vrei sa ma mai vezi ??????????
  • GHIMPU eu, Filat, Dodon, Lupu si multratatul VLADIMIR VORONIN am votat Transblacanica , ii sustinem si la pizdentiale
  • ORANGE moldcell huinea ce ai tu, orange o are mai lunga
  • vind un par din cur aaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  • oana precis va merge la baku ursu sau akord...ashtia kre au bani..castigatorul e ales deja demult..o sa ne pozorim
  • PUTIN Bai inka nu ne-am plictisit
  • jorik ei vinzari nu vor avea la asa telefoean, vor fi in stok si apoi le vor da ca cadouri
  • sms iaka oameni talentati, numai ca lor euroversion nu le trebuie,BRAVO BAIETI!
  • angela da din Romania cine merge la Eurovision?
  • ich copilasi, voi maine nu mergeti la scoala?
  • guest_10 cine-s astia??????
  • mikutza si totusi nu stie nimeni cind o sa avem rezultatele?
  • vera pipet
  • eu Printre 65 respondenţi cel mai frecvent răspunsul este "18 Dara “Open your eyes”". http://www.isondaje.ro/sondaj/250449196/
  • PUTIN Bai inka nu ne-am plictisit
  • nevermind poate jenya solid face vreun mix pe scena, a? ŞD
  • Mihaela shio creai pontu cu 21 cm?
  • vind un par din cur andreea mare kurva esty
  • Vicaaa synops va fi??
  • katy alt ceva nu ati gasit mai bun
  • La vot ))) Wai hai votati in ALTA parte ! )))
  • - pe Croitoru o sustine Korona : D
  • Mihaela vaabse ne po teme
  • Dina MAndinga reprezinta Romania
  • Moldcell andreea_ poate cu mine iesi? :) facem in 2
  • guest_112 @angela Mandinga
  • guest_145 juriul nostru cumparat va decide tot!cine a platit mai mult merge la Baku!
  • eyy Ursu nu are bani!!! ce-i cu voi?
  • ana* pina la ora 12...se trmina
  • Cristina) in vreo 15 min
  • katy rihana de exemplu
  • guest_148 pe 16 rezultate vor fii
  • cineva pedro-pedrila
  • lass croitoru are multe sanse la fel ca si akord
  • guest_145 hai Calancea!!!
  • sms alex calancea band
  • TU clasnaaa
  • ngelish fain cantec
  • guest_148 vapse asta tat i haita
  • katy balsoi pipet
  • oxana angela, Mandinga
  • me hai shnapi shnapi!!!
  • angela pentru ich: das ist richtig, Morgen wir gehen in der Shule
  • Lucho juriul acum imparte banii
  • oxana paralela 47
  • oana eyy-u iai vazut vilele?shi cati bani a cheltuit pu seara asta si pu clip?e bolnav omu cela
  • aliosha oameni in cit timp rezultatul?
  • ana* acrod si cristina kroitoru...si pasha parfeni..preferatii mei
  • ha oooooofff show maldovenesc
  • andreea moldcell ce propuneri intrigante aveti ?
  • shul vind un jitel
  • M_S_I Cum se voteaza de la tel. fix?
  • guest_62 shini is rahatii?
  • Moric ce trupa evolueaza acum?
  • eu eu votez calancea band
  • :)) am impresia ca baietii astia au fumat ceva vesel....nu inteleg asa stil de muzica fara vre'un napas
  • jorik angle nou nie este in pula un va duceti voi miine, hoti la gradinita, ascultati muzica si nu futeti capu
  • katy eu vind o vaca
  • Don Pedro eu dac cesn is patan normal)
  • me ziben ziben ai liu-liu, ziben ziben an tzvai!!!!
  • eu http://www.isondaje.ro/sondaj/250449196/
  • aliosha ma duc in dush
  • plinbarila guest61 unii moldoveni privesc pe site http://www.privesc.eu
  • shul cinta ca niste debili
  • admin pastrati un limbaj decent in caz contrar veti fi banat
  • Moldcell andreea_ antena cu conectiune 21G !
  • Don Pedro prosta oleac mam pricalit
  • mikutza sper mult ca Dara sa cistige...
  • Mihaela calancea band nus in concurs
  • shoimarel eu tot votez alex calancea band!:)
  • cineva da ce se screm si acestea pe aici?
  • blablabla bai, da au ales astia o trupa....noi ce vina avem ca tre' sa-i ascultam?
  • ghita azi 11 martie e concurs la turcuvision and best frends.
  • jorik admin, de ce? faceti sa fie liber, ce e cu cenzura?
  • guest_73 Dar eu îl votez pe Moş IOn Roată!
  • guest_148 undei pavalas bun chintecel
  • qqqqqqq de mult trebuia banat limbajul
  • om Eu nu ştiam cine este Alex Calancea Band. Acum ştiu, o să cumpăr vre-un CD.
  • guest_24 admin acum te-ai trezit! In sfirshit!
  • sandu iaca Alex Calancea Band rupe
  • Vicaaa lumeee la noi degraba in MD Daft Punk vin da voi spuneti de Eurovision!!!Pregatitiva mai bine de Daft Punk
  • Moric ;))) si fignea ))
  • guest_161 Moldcell,cam mica antena (:
  • Eurovision Daca continuati sa discutati asa murdar si urit noi vom fi nevoiti sa blocam pagina... Va rugam aratativa cei 7 ani de acasa
  • guest_238 pzdts
  • euro parca aceea albastra din 5 element
  • blablabla astia zici ca-s la repetitii
  • om Vica, serios? Dă informaţii mai multe.
  • Michelle la mine se cam "gruzeste' site-ul,la voi merge bine?
  • Don Pedro eu realina la padruji dau de futut
  • cucu astia nu-s sanatosi la cap
  • admin gura blea totii
  • guest_148 hai la varrr lumeeeee
  • - lo :d :d :d :d :d
  • Lesika biln si bdred
  • puta de cal doamne ce glas
  • Don Pedro nu mam futut de jumate de zi dam
  • plinbarila da,da,da,da,da,da
  • shoimarel rupe Calancea!!
  • guest_24 admin, baneaza individul cu vind un par...
  • ich pentru angela@ Ich glaube, dass du "Schule" gewollt geschreiben
  • WTF ce cotcodaceste asta??
  • lol parca cotcodacesteeee
  • plinbarila super
  • sms calancea respect!
  • vind un par din cur lida si vb aiurea in skype sii ku tine aaaaa?
  • asd123 Michelle,merge fain
  • andreea care admin mey ??? voi nu vedeti ca toti politicienii sunt aici ?
  • eu piesa e faina si trupa tot dar solista ii cam alunga pe toti sin parcare
  • guest_148 pipetz
  • urski fac ca gainili :D
  • guest_24 si pe don pedro tot!
  • lol mai au sa cinte astia? :????
  • terminati daca noi singuri " molodovenii" nu ne iubim atunci cine o so faca?aveti un pic respect pentru voi la urma urmei ce suntem cu totii ? oameni nu?
  • shul bai admin tu intii pastreza limbajul decent si pe urma fa observatie la altii
  • katy ca la debili
  • phillo imi place baiatul cu tricou si caciula alba ^_^
  • guest_159 :))))))))))
  • ress cotcodac
  • ((( mult au sa mai cinte acestia??
  • irinaa tare faini baietii, vreau la concert
  • ffffff :))))))))))
  • shoimarel eu nu inteleg care e functia adminului pe chat-ul asta?! o gramada de ciobani au intrat si fac ca oile!!
  • andreea Doamne cata naivitate
  • Michelle asd123,ok,mersi mult,inseamna ca la mine e ceva ne-inregula cu net-ul
  • guest_10 talente ca talente dar cita educatie la noi in moldova tii rusine sa citesti comentariile voastre
  • jorik Don Pedro e o persoana respectabila, nimeni nu trebuie sa-l baneze
  • eu www.isondaje.ro/sondaj/250449196/ votati
  • vind un par din cur zdobb\
  • vind un par din cur lida da minietu il faci zaebisi???
  • ffffff numai a nostri pot sa cinte asa intraiurea
  • katy vind puteofshi la dur dom
  • buburuza ^_^
  • andreea hai banati-ma pe mine
  • angela pentru ich: ich can nicht so gut schprehen
  • guest_24 da, da ADMIN, si pe jorik tot!
  • euro bunica bate toba
  • Vicaaa Daft Punk si'au inceput turneul, deacu ce va fi in puterile la moldcell sau orange sa ii aduca in md , speram, se presupune ca vor veni, dar precis nu se stie, mai multe detalii puteti afla in torrents md , este o grupa cu daft punk,acolo si am gasit) bafta)
  • solnishko astia`s repetitsii la dinshii sau kum :D
  • Moric omg )))) kill myself ))
  • ress :d
  • guest_177 o boje ce kintec :D
  • Mihaela plagiare online
  • Tate Iaca unde-s Zdubii?
  • asd123 Michelle,probabil,sau poate o fi de la calculator...vezi si tu
  • shul cine oare au sa chistige cum credeti
  • cucu ce se cracana astia aici ca debilii
  • Natasha` omggg bunika bate toba_))
  • websecurity dupa ce se anunta kistigatorul rog s continuati cu discutiile indecnte...faceti pe skype o conferinta...da aici arati educatia
  • me facepalm
  • mikutza imi pare ca sa cam abatut lumea de la tema...
  • Red cinei asta?
  • om Vica, mulţumim, eşti o dulce.
  • admin vind un par din cur, schimbati nick-ul
  • guest_158 ei se incalzesc :D
  • guest_54 poate ii trimitem pe dinsii la eurovision
  • misca pulimiotcic Dara merita- cea ma reusita piesa
  • shoimarel am pierdut mult ca nu am fost la concert la Calancea!! buni baietii!!
  • ghita dejavu
  • blablabla cine e tipa asta cu vocea? ar trebui sa se lase de muzica
  • vind un par din cur am sa te zaibesk eu singura vb urit
  • WoW Bun mix...
  • guest_24 ei au adunat piesele ce ne-au reprezentat la eurovision :) nice!
  • *** :d ujas
  • Mihaela chiar cinta klassna
  • urski buna ideie sa faci un rezumat,bravo
  • andreea admin du-te mamii si te odihneshte ca ma epuizezi !!!
  • cineva da cite minute tine o piesa cu acestia..?
  • guest_112 Loreen - Euphoria HQ (Sweden Eurovision winner 2012)
  • didadam blablabla iar tu de comentat
  • oana https://twitter.com/#search?q=%23eurovision deci ne-am pozorit pe nota 10
  • Amy bla bla bla tu ar trebui sa te lasi de vorbit
  • Don Pedro vseo mam zaebit de maturi
  • guest_211 talentati!
  • lololo ma doare capul deja
  • Mihaela in an Trans Balkanica au cintat dupa concurs poate aceshtea vor veni la anul
  • miki place cum cinta, buna voce are fata
  • Vero loreen - euphoria hq (sweden eurovision winner 2012) superrrrr
  • Don Pedro amu dam as vb mai frumos
  • Don Pedro pentr mat sorry
  • guest_62 loreen - euphoria hq (sweden
  • guest_62 loreen - euphoria hq (sweden
  • eu_si_cu_mine o_O Cine stie cit mai cinta acestia???
  • guest_62 loreen - euphoria hq (sweden
  • lololo nici un sens n-au cintecele estea
  • guest_62 loreen - euphoria hq (sweden
  • shoimarel da ce buni sunt!! de ce nu au participat cu o piesa ceva?
  • guest_62 loreen - euphoria hq (sweden
  • Chuck Norris Dara trebuie să cîștige, și apropo, vorbiți mai decent!!!
  • Amy aici intra numai malaletcele sa puna comenturi stupide. Daca sunteti asa de desteptii unii apucativa voi de cantat sa va vedem)))
  • shul cred ca cristina croitoru o sa chistige
  • guest_211 ta-tăl meu e par-la-mentar,lai lai lai
  • Chuck Norris ițm the best!!!
  • shul piesa suedia e super
  • Mihaela Amy za sibea gavari
  • eu ia da trece greu timpu ista
  • True mdaaaaaaaaaaaaaaaaaa.... daca Tarasiuk merita asha lok ap eu-s tank.
  • Kris Parfeniiiiiii
  • ORANGE aici pute a korona
  • eeeeeeeeeeeeeeeeeeeeeeee cei din publik au ramas fara cuvinte vazindui pe acestea
  • Maia Laguta cine castiga?
  • Hitler Parfeni castiga.
  • Vero shul dustin
  • kkk Amz mai bine ai suge p...
  • linda guest_62 o ascult acum
  • Tiziana Cine castiga?
  • Amy Mihaela zasibeisa sama)))
  • kalashnik Dara o sa cishtige ..
  • Chuck Norris Chuck Norris căștiga orice Eurovizion!!!!
  • shul parfeni la parasa
  • guest_62 loreen - euphoria hq (sweden
  • guest_62 loreen - euphoria hq (sweden
  • solnishko sk**.....m`o saturat de`am...poate sh are voce....dar doare kapu` de`am.....:(
  • guest_62 loreen - euphoria hq (sweden
  • guest_211 go parfeni! mie imi place cîntecul
  • guest_62 loreen - euphoria hq (sweden
  • guest_62 loreen - euphoria hq (sweden
  • guest_24 Pasha Parfeni
  • galea cit mai este pina a afla cistigatorul??
  • ghita Acum conteaza cine si citi cumatri are in juriu
  • ivanturbinca tarasiuk se dadea la mine in rutiera vara asta....imi cera nr de tel :D
  • vind un par din cur ap shi dar'?
  • mikutza Dara-the best!!!
  • Chuck Norris eu castig !
  • wfl pasha go
  • galea mai este mult ?? pina la final
  • Mihaela Amy invatzate a scrie
  • eu da hai odata ,ka amus dom 2 se incepe :DDDD
  • ghita Rominia is the best.
  • guest_211 ryan gosling the best!
  • guest_141 blin cit mai are d eicntat?
  • lkj te uiti la parfeni si intelegi de ce trebuie votata lege pedera... altfel trebuie sa fuga din tara
  • Maia Laguta de mine tot tarasiuk, se dadea !!!
  • guest_29 nu vati saturat sa comentati???????
  • cretzulea ma dor urechile de la ea...........ugffffffffffffffffffff nu mai pot .......mai miauna mult oare asta ?????
  • Mihaela shi care are mai multzi bani pe cont
  • Chuck Norris cind o sa permit eu atunci o să anunțe și rezultatele!!!!
  • True ivanturbinca - :D:D matinka se pregatea sa stringa voturi de pe atunci ))
  • Tiziana cati au mai ramas sa cante?
  • galea cit mai este pina a afla cistigatorul??
  • katy dara suntem cu tine
  • linda Tati bla bla dar mai bine ati face ceva nu ati sta sa birfiti aiureli!
  • kira Cine stie, peste cit timp rezultatele????
  • ich fratilor, sincer...merita cineva sa mearga la Baku? nu prea am vazut originalitate....de altfel, sanse nu are niciun concurent
  • andreea mihaela invata-te si tu sa scrii
  • olguta27 da eu deamu dom 2 am privit online:))
  • JANEL inkidetiii cineva pe imbecilii astia !!!!
  • ((( mai avem mult de asteptat?????
  • Amy Mihaela cred ca tu ar trebui sa inveti a scrie nu eu! Oamenii defectele lor vad la altii)))
  • shoimarel e greu jazz-ul pentru manelishti !:))
  • Vero fabrica de staruri pe primemerge acum?
  • shul malaletci care nau ce face stau aici si scriu prostii
  • lkj linda dute si teculca
  • linda Cristina Croitoru si Pasha sunt buni!
  • Evelina inainte de a va da cu parerea, verificati mai intii gramatica!
  • ivanturbinca tRUE..noroc ca am intilnito pe dara inainte--votati dara
  • Lucho ce mai face Ventzeslav?
  • Vanga buna seara lume, ce se mai aude pe aici ?
  • olguta27 tiziana interpretii deja au cinat toti asteptam rezultatele
  • Mihaela andreea sint mai invatzata decit tine...v atli4ie at tebia ink nam primit invitatzii de la 21 cm
  • linda Multumesc ca mi-ai amintit, iaka chiar plec :-*
  • vind un par din cur tat zabisi
  • Yes Vreau sa aflu cistigatorul, cit mai au de cintat:(
  • solnishko Ia`......Sk***..........zai*** deam kintarea asta.....................M`ai au mult di neunat pe scena??????
  • guest_246 cand se termina cantecele astea?
  • Tiziana merci
  • alex Va castiga Pasha Parfeni ori Croitoru.
  • Chuck Norris lu' Chuck Norris ii bine!!!!
  • ANDREYKA Anul asta romanii au reprezentant foarte bun zic eu , la noi nu prea avem de unde sa alegem anul asta , eu tin cu romanii
  • andreea la alungat pe venteslav sau nu?
  • Tiziana cine credeti ca are sanse?
  • guest_62 mai au de cintat
  • Puff ce amuzant e să-i vezi cu sunetul zero, numai jazz zici că nu-i... :))
  • lol trag de timp oamenii....
  • limon mai au multtttt???
  • olguta27 ventzeslav a scoso din dus pe sotie si a spus sa se duka in jenskaya spaline
  • Hitler Ce sa se auda? Muzica de prost gust
  • shul dara parasa
  • euro run away
  • :)) epic sax guy ver. 2
  • geo blin aistea cu muzica lor plitisesc lumea
  • guest_247 băieţii cîntă super
  • Cristinuta ma plictisesc
  • galea cit mai este pina a afla cistigatorul??
  • sweety ce brediri mai cinta
  • Mihaela Amy eu sint mai deosebita vad defectele tale in tine
  • galea cit mai este pina a afla cistigatorul??
  • guest_24 Admin, pe tine miine te elibereaza din functie sheful!
  • galea cit mai este pina a afla cistigatorul??
  • misca pulimiotcic tu esti parasa
  • buhuhuhuh Evelina, "mai intii" sunt cuvinte incidente in fraza ta si vor izolate cu virgule. Gramatica,zici?
  • kuku aaaaaaaaaaaa,,,,rupt băiatu.
  • Vero fabrica de staruri arata acum pe prime?
  • galea cit mai este pina a afla cistigatorul??
  • ghita sasha bobgnibov - rulez.
  • 21 cm ma duc la prasit cactusi
  • katy dara are sanse
  • Tiziana fu.....ce plicticos
  • Chuck Norris Chuck Norris e mai admin ca toti aminii !!!!
  • Amy Mihaela esti o proasta)))) mie mila de tine
  • shul cine la romini anul acesta o chistigat
  • galea cit mai este pina a afla cistigatorul??
  • esmy place band-ul, bv!
  • sweety croitoru o sa cistige,pe ea o sponsorizeaza Corona
  • guest_13 da cinntecele is concinii vapshe
  • -Man Darinas- Manciu o mai ramas pina in finala?
  • euuuuuuuu http://www.youtube.com/watch?v=Z4PMQB5zmAU uitativa
  • ivanturbinca tarasiuc are un candidat pt presedinte :D
  • shul nu arata
  • galea cit mai este pina a afla cistigatorul??
  • Amy deosebita in ce? in a vorbi aiurea? sunt DEACORD !!!!)))
  • Michelle ma dare capul de la muzica asta a
  • Amy ha ha))
  • guest_29 y
  • Don Pedro eu is admin we
  • galea cit mai este pina a afla cistigatorul??
  • Tiziana de la romani merge mandinga
  • galea cit mai este pina a afla cistigatorul??
  • olguta27 la romani mandinga
  • guest_29 r
  • galea cit mai este pina a afla cistigatorul??
  • ich tipii astea canta mai bine decat, intunecatul cu russoaica etc....
  • limon aaa o intreabare tutoror>cine imi spune cind se incepe fabrica de staruri?? please
  • galea cit mai este pina a afla cistigatorul??
  • ]]] blin, da cit 30 minute tre sa cinte????
  • galea cit mai este pina a afla cistigatorul??
  • Cristinuta canta bine, dar n-am chef de ei acum
  • guest_56 mai au de cintat nebuni astia??? :)
  • guest_211 vind o caldare de cactusi
  • galea cit mai este pina a afla cistigatorul??
  • klm hai cind odata rezultatele ca tre sa ma culc, miine la lucru
  • galea cit mai este pina a afla cistigatorul??
  • :)) noroc da patanu cu fes alb , fara saxofon grupa e zero
  • Yes Oameni hade-ti sa dormim, eu cum am inteles ei ne tin de nebuni daca ne-au pus asa muzica
  • lol la mn e pe mute :DD
  • Tate Guys, ce-i cu voi? Parca asteptam rezultatele, ci nu ne svadim si tot fel de aceste chestii.
  • guest_24 ce mai vorba, Don Pedro.. du-te dar si te culca!
  • qqqqqqq sa fost anul acesta Turcu, precis ca castiga....
  • Don Pedro andreea mai esti pe loc?
  • Michelle horror
  • XXX jos coruptia
  • lena Uff...Capul meu..
  • galea pe 17
  • shoimarel am zis eu ca pe manelishti ii doare capu de la muzica asta! :)
  • Don Pedro dam nii dor de tine
  • kuku de asta și avem așa concurenți,,,nu suntem educați și nici pregătiți să acceptăm astfel de sunete,,care pentru unii brediri pentru alții,,,purul adevăr
  • Chuck Norris Chuck Norris cu bognibov spala wc-ul!!!
  • shul cu cit
  • Mihaela Amy ziceai ceva de defecte cred k ai ziso exact la tzanc defectele tale le vezi in altzii ashai!....ni4ivo praidiot pirijiviosh
  • galea fabrica
  • Cristina) azi e fabrica de staruri
  • andreea mihaela : ar trebui sa-ti para rau scumpo , nushtii ce pierzi :d cat despre gramatica limbii romana ai demonstrat abilitatile tale mai jos
  • galea cit mai este pina a afla cistigatorul??
  • vv olguta... da da kiar e bun cintecul Mandingai
  • Cristina) vezi acum pe prime tre' sa fie
  • 21 cm don pedro_ andreea merge cu mine !!! laba !
  • Yes Fabrica de Staruri se incepe pe 14 martie
  • cgchv suuuper alex calancea band si DARA
  • galea cit mai este pina a afla cistigatorul??
  • daaaaaaaaaaaa super http://www.youtube.com/watch?v=Z4PMQB5zmAU
  • Tiziana lasati acum gramatica....
  • aliosha ink nui rezultatu`?
  • Mihaela andreea dak nu intzelegi shi vrei so faci pe culta e problema ta
  • Don Pedro andreea daa de unde asa desteapta vii?
  • aQua bass chitaristul e super!!! :))
  • andreea suntttttt
  • guest_177 vrio 20 min
  • fff m-am saturat de acestia
  • Tiziana pace tuturor si discutii civilizate
  • guest_211 calancea virtuozi! bravo baieti
  • galea cit mai este pina a afla cistigatorul??
  • Vero @ yes mersi mult!!!!
  • ea da nu ii doare gura atita sa infli capu la lume?)))))
  • Vanga vand otrava, pentru guzgani shioarishi sh tarakani...
  • shul pe 17 martrie incepe
  • galea ah
  • Mihaela andreea cam nu prea tzi se primeshte
  • Don Pedro moldcell la tine ii pre scurta)) asac ablom
  • galea mult
  • Tate Tiziana, de acord.
  • limon PE 17 martie sau pe 14 pina la urma ??concretizati va rog...
  • guest_117 tiziana bravo
  • Admin Liniște.
  • QQQ sa fost Turcu, precis ca castiga anul acesta
  • guest_177 fabrika pe 17 martie?
  • sweety calancea la culcareeeeeeeee
  • Trance CHiar nu avem noi in Moldovioara noastra ceva bun sa audiem? Lumeeee scapatine de asta :(
  • Amy N-am zis nimic de rau) Doar am zis ca mie mila de tine! Comentezi aiurea si faci o multimea dea gresele! Si apreciazate! Vorbesti in romana sau in rusa)))
  • galea la 23.00??? tare mult avem de steptat
  • limon multumesc tutoror de raspuns ...
  • Don Pedro moldcell lana dupa mine as treaca s pe la tine!)) gasesc limba comuna cu fiecare
  • 21 cm andreaa_parca ne-am inteles , iti arat antena :)
  • Yes Vanga acum dupa asa muzica otrava ta este forte utila cu cit o vinzi?
  • shul pe 17 precis
  • Lucho pe 17 primul concert
  • guest_211 e buuun
  • BORALA totzi artishtii sunt de rahat !
  • Chuck Norris cine stie vre-un magazin de echipament sportiv mai ieftin????
  • guest_177 oo..in sfirsit*
  • linda mda..ce dureaza atita...
  • verry e buna muzika imi place
  • euro eu mooooor
  • limon lucho multumesk frumos
  • mim pai el si este Alex Calancea-bass ghitaristul
  • ew si cu mcredetei baieti si fete cine se va duce si anu ista sa ne faca de ris si prin BAKU?
  • katy amy mai bine taci
  • WTF DA cn o intrat in concurs din cei 12 La Fabrica!!!
  • Mihaela Sa nu te intereseze inc e limba vb oricum n-ai avut asha onoare s vb cu mine.....ashaka Me4tai dalishe!
  • lokryd dai ra dira dam mam saturaaaaaaaat
  • Cristinuta Vanga, dupa asa muzica e inutila otrava... au murit toti deja
  • -Man Darinas- Seamana cu cintecu Nelei Ciobanu
  • ew lindfa dureaza atita pentr uca merge acu acolo tender
  • Vero pe 17 concert, da din casa nu arata mai inainte?
  • Chuck Norris cine merge la piva?
  • shoimarel sta slab lumea la noi cu muzica!! calancea rupe si gata!! cui nu-i place sa asculte manele!
  • oana galea 15 min e asa mult?
  • Lucho cu placere
  • iuh aaaaaaa
  • Don Pedro andreea unde teai pierdut? esti libera?
  • linda Eii chiar de ris....
  • wfl da psd.......o zb dea..........stingetilelumina
  • sandu Super tare !!!!!!!!!!!!!!!!!
  • kira cine e fata care cinta? E cumva Cristina Pintilie?
  • iuh aaaaaaa
  • TZUTZA eu cred ca pasha o sa catsige , sau cine acolo e mai bun drug cu juriul
  • Vanga in cazul dat e nevoie de o otrava mai concentrata :D e mai scumpa, am luat-o din viitor, 50 de lei gramu.
  • ana* oo..da aici la moment in evolutia la eurovision..e playback 100 %
  • Michelle doar ma fac sa ridde la mesajele voastre stupide si de prost gust
  • Amy katy mai bine ai tacea tu si ai sustineo pe prietena ta la invatatura
  • Tiziana pai...la noi in tara se plagiaza din greu
  • 21 cm don pedro_da a tine cat are? ))
  • Trance Ma invitat un prieten la BAKU la eurovision mie rushine sa merg
  • aQua nam stiut ca el e )) e bravo
  • ghita Jhesikah RT @Rhys_Fantastico: i feel sorry for the audience..... #eurovision #moldova 2 seconds ago · reply · retweet · favorite
  • Vero pe 17 concert, da din casa nu arata mai inainte?
  • :P:P:P:P:P............... amy....шото ты слишком цивилизованная............ Gura mare face okiu vinat :D:P
  • Hitler Sehr gut!
  • WTF DA cn o intrat in concurs din cei 12 La Fabrica??
  • mim Dragi copii linistiti-va si mai bine ascultati adevarata arta muzicala!!!
  • God da e foarte putina lume in sala acolo..... multa reclama si putin efect
  • cgchv alex cancea band ARDE
  • ivanturbinca vanga cind e sf lumii?
  • shoimarel da e Cristina Pintilie
  • lokryd o pingvin4iki
  • Tigra amin ) xd
  • olguta27 fata e pintiliuc familia ceva asa
  • guest_216 cum sa ie numarul
  • guest_216 ?
  • linda ew...da da, se gindesc care da mai mult!
  • ich Pintilie??? aaaaa, s-ar putea.....banuiam si eu
  • Trance cu 5 min in urma priveau aproximativ 1697 acum 1597
  • Vero You know when something funny goes on too long and stops being funny, then keeps going til it's funny again?
  • ew ei acolo mai dovedesc si o mica sauna sa se duca
  • VADIMEL mmm....aistea cre cinta acum parc is paralizati....rip
  • :P eu aadorm..:D
  • VANGA azi ii sfirsitul ce nu simti
  • wfl mim: dats o palma
  • Mihaela Amy klar cu tn buna attibeala...original n-am ce spune(kstati de defecte ai asha de multe tu mi le aratzi)
  • 210000 km andreaa !!!!! :(((
  • guest_211 alex calancea band sînteti cei mai buni!
  • offf au obosit sarashii
  • Coolerandrey cine ii oaia asta mai?
  • Panfile unde pot sa gasesc un decodificator????
  • linda guest_216 Ce fel de numar???
  • $ 1746
  • WoW la mn is 1694
  • irka poate ii trimitem pe astia?
  • Irina That awkward moment when the moldovan interval acts lasts longer than your sex
  • Bloodvik 1748
  • Trance offf, :D
  • WTF hai blia zaibal cit mai au.........
  • guest_122 muzica la mincare
  • stells strasnicccccccccccccc
  • WoW 1752)
  • -Man Darinas- m-au saturat, sa nu deie cn sa cistige aestia
  • wisky deja e plictisitor
  • Vero You know when something funny goes on too long and stops being funny, then keeps going til it's funny again?
  • aQua 1752
  • ana* kum poti sa sari in sus 20 de mihn. in kontinuu ? :d
  • WoW si incepe sa mearga iar greu.... >:)
  • linda AAA, la mine 1748
  • Trance da au mai aparut
  • shul super
  • Michelle Andreea voastra tre sa doarma..:D
  • guest_24 1753
  • Nata mau plictisit
  • Cineva 1757
  • :P 1747
  • ghita Compozitor Pavel Turcu.
  • ',') Shi di debili si si de leva cinta
  • tina vad ca la toti le place)))))))))))))))
  • Trance nu stiu cei asteapta :D
  • katy nu cred ca o intreci
  • Bloodvik Vero vad ca vrei sa pari inostranca :D
  • Kristinuta 1757
  • io-maio crd ca gata!!!
  • om Bravo :)
  • galea hai data ca m-am saturat sa astept
  • ich ooofff, ce legatura proasta face netul asta, de aia ne obosim rau
  • didadam totusi poporul nostru nu e educat sa asculte instrumental...bagati niste banalism ca sa le fie pe plac..tara cu gusturi de rahat in pana mea. Alex Calancea Band vrem concerte cu voi
  • Tigra zakalibali )
  • ghita Flori va rog
  • ew baieti parfenii a adus fetee din kiev ca sa faca ceva placut la juriu si de aia lea platit lor 3000-5000 euro
  • $ WTF tacati fleanca
  • ana* in sfirsit :d
  • God in sfirsit )
  • olguta27 uraa
  • shoimarel muzica asta e pentru cei cara stiu ce e muzica!
  • guest_211 uraaaaaa
  • offf cum de nu vor la bacu?)))
  • Yes Muzica aceasta deja dureaza 18 min, graznic :(((( nici o stima, sunt nemultumita complet de serviciul oferit de Eurovition, in afara de modul de organizare:(((((((((((((((((((((((((((((((((
  • :P in sfirdit au terminat
  • andreea daca-s libera ? Intrebarea suna cam stupid , libera sunt pentru ca traiesc in tara democratica ... Mi-ar placea sa shtiu cati ani ai ca sa shtiu cum sa vorbesc mai departe cu tine nu vreau sa sufere un suflet atat de inofensiv si naiv
  • Amy Mihaela te-ai gandit mult pana ce ai pus ana pe claviatura?
  • GOGOASA decodificatorule la mine dragul meu!!!
  • Topo finallyyyyyyyyyyyy
  • linda Gata....ii bun
  • WTF Shi cishtigatorul Eurovision este....
  • ea naconetztaaaaaa
  • Tiziana puse la olalta...ha ha
  • WTF kzdms ink 15 min
  • sandu bai proshtilor nu judecati ka ei kinta foarte bn da voi dak nu shtitzi ce-i muzika ap tasheti
  • Amy sorry mana
  • Of Dar Voi va da-ti seama ca baietii astia canta atat pentru ca Asa li s-a cerut. Plus ca ei improvizeaza atat sa treaba timpul
  • Trance :d:d
  • Tigra urraaa...am stopat sa beau aspirina :D
  • sweety ce microfon are prezentatorul? ca la moldoveni)))
  • guest_139 Euj.În finală se va promova GB
  • :)) inca 15 minute de ujas
  • guest_246 nu e pregatita
  • Irina Is the clock in the corner the time they've been playing?
  • ivanturbinca daraaa
  • DJIGURDA iojkin kot mai repede ca vreu s ma culc
  • guest_246 o sa fie prea mare socul
  • VADIMEL cistigatoruuuul este....paaaaaaaaavel turcuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
  • shul amy tu intii invatate sa scrii
  • lokryd i guess not lol
  • MAIUL toti nebunii la Baku.....
  • God Eu zic ca oricine va pleca la Baku oricum va fi o prestatie slabutza )
  • katy ha ha ha
  • euro in azerbadjan e frumoasa muzica nu ca la noi
  • :P vreau sa cistige DARA
  • offf asha,,,teleenciclopedia se incepe...
  • guest_211 microfoanele prezentatorilor arata jălnicuț
  • Tate E frumos pe acolo.
  • guest_205 Dara !!!!
  • alinuta333 ursu va pleca este deja decis
  • lol haiii mai repejor anuntati rezultatele...adooooorm deja
  • $ God sunt deacord
  • vind un par din cur if you age is on the clock you too young to have a cock )))))
  • oana https://twitter.com/#!/search/%23eurovision lume cititi comentariile strainilor..ne-am facut de rusine mai mult ca niciodata
  • MAIUL nici in finala nu va nimeri Moldova
  • guest_62 o tara de musulmani
  • Tiziana credeam ca va vorbi vreun reprezentant ceva din bacu,
  • kira Marcel Spataru erai un papa lapte pe cind invatai la USM FRISPA, da acum vad ca te dai tare in parcare! halal prezentator din tine! Plingeai ca ai restante, numai prostii ajung cu bani peste tot!
  • Trance anul asta e timpul lui Pasha sa kistige!!!!!!
  • mikutza trebuie sa cistige Dara..
  • verry bani cheltuiti in zadar, doar se promoveaza ei singuri pe banii statului
  • sweety nu cred ca moldovenii vor avea o prestatie mai proasta ca babele rusilor
  • limon sunt cineva de aici liceeni?
  • cgchv dara !!!!
  • Don Pedro vot i pomer ded maksim da i hui ostalsea s nim polojili ivo v grob. hui upersea v potolok. on zdaravennii bil mujic on na huiu vertel saslik huem griadki on kapal huem griadki polival. a sasedcu tiotiu zinu on ebal cerez carzinu a saseda deadiu grisu huem kinul 4erez crishu a v grajdanscuiu vainu on spas diviziu odnu nemti nashim perekrili nemti nasih perelili aded shirinku rastenul i hui nad recicoi protenul nashi pohuiu proshli nashi nashih pronisli a za nimi nemtzi v speati stali na hui nastupati ded zalupai galihnul nemtzev v re4ku okunul a teh kto plaval po vade on bil zalupoi po golove posle boia gheneral emu zalupu teloval
  • guest_205 ma temmm acolo la baku arabii pe dara :D sa no furreee
  • guest_226 Marcel Spataru rupe toate intrebarile )))
  • ghita Ion Suruceanu critică finaliştii selecţiei Eurovision: Ai noştri nu au ce căuta la Baku
  • ivanturbinca dupa sondajul de aici dara e aleasa
  • Cristy care sunt prezentatorii?
  • X Iluia ! :P
  • stells ma duc eu la bacu
  • guest_211 ce rasisti sinteti
  • ghita http://unimedia.md/?mod=news&id=45344
  • aQua Human Place & MC Mike nr.10
  • katy dara va cistiga
  • guest_5 fa bani din poker ID Skype: acc_Poker9 pt mai multe detalii
  • Don Pedro la mine kam ca la ded maksim ii))
  • linda maiul nu cred...
  • gavriil oricine numai nu adrian ursu.kiar e jalnik s ti uiti la el
  • misca pulimiotcic dara
  • shul da eu
  • cgchv dara !!!!!!!!
  • shul ce vrei limon
  • Tiziana adrain ursu are succes doar pe la nunti
  • linda gavriil deacord ;-)
  • True manciu merita un lok mai bun!!!!!
  • guest_211 parfeni!!!!!!!!!!
  • sweety dara va cistiga primul lol de la coada)))
  • misca pulimiotcic Dara merita
  • andreea shul si tu invata-te , oameni nu ati auzit de cuvinte ce se scriu prin cratima ?
  • offf multi cai la bacu....trebuia un remix pentru sanie cu zurgalai....
  • BANI POKER poti sa joci poker...cistiga zilnik
  • tu m-ă știi dara
  • gaga poate pana maine aflam si noi castigatorul........da trag astia de timp nu gluma
  • Mihaela care ana sau mana....se vede k singura nu prea gindeshti mult inainte de a scrie......nu mam coborit la asha nivel(iarashi vb despre defectele tale)
  • verry imi spune cineva cum se numeste formatia care a cintat acuma la urma
  • VADIMEL luuumeee lumeee soooro lumeeeree...vai de capu nostru lume(
  • alinuta333 chiar nu va dati seama ca deja totul este decis si cumparat
  • wfl pasa
  • 1 1
  • ana* dara a avut o piesa destul de buna si mia plakut..dar...nu prea cred ca ea o sa cistige
  • Iluia Panfile!
  • BANI POKER bani din poker Skype:acc_poker9
  • ghita Pregatiti-va Sa primim Eurovision. la pastele calului
  • Crazy dara
  • Tiziana alex calancea band si cristina pintilie
  • linda Calancea Band
  • limon eii...daca suntezi liceeni..mai filtrati un pik vocabularul!!!
  • dadamdam verry alex calancea band
  • shoimarel Alex Calancea band
  • DJIGURDA e*ati kak ya liubliu pirog
  • ana* da ce vrei sò dai in judecata..pe formatie? :d
  • Cristina) alex calancea band
  • Milania paralelllllaaaa..........speram!!!! votam!!!!!!!
  • Bloodvik ghita - :D
  • guest_62 haaaaa
  • esmy vreau un baiat sa mearga in Baku - fie Ursu, Parfeni sau Akord
  • Crazy dara
  • Mihaela andreea las-o mai moale nu incorda asha tare dictzionaru...
  • NUTZA Ce parere aveti despre Inaya?
  • gaga da poate Moldova sa suporte un astfel de concurs?
  • MAIUL ultimii au fost Kalancea Band
  • Don Pedro andreea esti pre desteapta, nii deestea ini plac
  • 1 pastele calului este conform unei legende odata la 7 ani sau conform unei alte versiune este atunci cand :
  • ana* ooo...alte rochii :d
  • vind un par din cur jitzika
  • vind un par din cur ne flatezi
  • linda aha
  • vind un par din cur :d
  • offf ce bine e sa revenim in Moldova))) .... la prezentatorii nostri... shik shi kititz)))
  • Don Pedro mine esti liobera?
  • WTF eee kzdms shi tu eshti pi..os
  • kuku mutre aceleaș
  • BANI POKER skype ID: acc_poker9 - pt informatii m detailate
  • ana* ianaya....frumoasa...si o piesa la fel de buna!!
  • eu vai ce rokii :D
  • Vanga o transperat in acelea :D
  • nico frumoasele noptii
  • guest_211 o bozjeee șiic ))))
  • shul liceenii vorbesc destul de civilizat
  • God in Moldova Eurovisionul nu va veni nciodata...nici in top 3 nu cred ca ajunge vreodata )
  • euro oau marcel ne flatezi!
  • tu m-ă știi serios sa fie alegerea corecta
  • Kris unde pot vedea cum decurg voturile??
  • guest_62 urrrraaaa
  • stells sttelsssssssssss
  • Tiziana prezentatorii sunt slabuti de tot
  • Tate Aham... primele rochii de la Rhea Costa erau frumoase, dar astes...
  • Topo alegerea corecta.......macar ai de unde face alegerea corecta?!?!!?
  • God p.s. prezntatoarele sint rele de tot
  • shul acolo tarani neductii vorbesc ca niste necivilizati
  • guest_189 la anul, ne vor spune!!!!!!!!!!
  • olguta27 ink 10 minute :),oofff
  • guest_158 iaca de ce au acimbat hainele !
  • offf elvetia?
  • limon nu stiu de ce..dar nu prea se observa..
  • pfffffffff lollll ce-s cu kuklele astea de prezentatoare?!!!!!
  • guest_169 And now, 20 minutes of commercials....#eurovision #Moldova
  • Mihaela andreea esti cea mai intrebata in seara asta.....cred k asta la tn se numeshte deshteptaciune?eu am alte viziuni despre asta
  • toarna un stakan di JIN way sini merji la baut?
  • Cristy este si camera verde?
  • ivanturbinca votati daraaaaa
  • andreea Scumpule Don Pedro am raspuns mai devreme la intrebarea ta despre cat de libera sunt
  • guest_211 ia să vedem
  • Cristinuta in sfarsit muzica
  • shul limon tu tot esti liceian
  • fff da cine-s acestea?
  • ana* simpaticuti..reprezentatii..la nu stiu kui?:D
  • 1 ujas, da eu ma temem k la noi ii rau
  • limon Shul..este posibil
  • DJIGURDA la ce ora sint rezultatele cine stie?
  • guest_62 swizerlant nasol
  • offf elvetia?...nu ...nu am vazut))
  • stells karoce
  • milly miroase a U2 si vocea solistului Bono
  • JustAGuest prikolina cinta
  • God in loc de acestea mai bine venea Mandinga sa cinte )
  • Irina aaaaaaaaaa, de asta a durat asa mult, sa aiba timp prezentatoarele sa se schimbe
  • Coolerandrey czxvzv
  • limon sunt liceean..ei si ce?
  • -Man Darinas- Interesant la belgieni-i cinteku parca ias dat in top 10 da parca nu...
  • Don Pedro is scump dam) placut)
  • klm tze kto?
  • linda Chiar cind rezultatele, ca ma plictisesc?
  • eu e foarte aiurea piesa la astia din Elvetia
  • WTF La ora 23:00 rezultatele
  • VADIMEL eu zic ca daca au cheltuit un milion de lei,puteau s investeasca si ceva in prestatia prezentatorilor de ex.....
  • Ariana e dragutz solistul:)
  • DJIGURDA ms
  • guest_62 mai venea loreen din sweden,decit astea???
  • ivan oare sau schimbat si bikinii prezentatoarele
  • andreea Mihaela : fetitzo ce te face sa crezi ca parerea ta pentru mine conteaza ?
  • 1 http://www.youtube.com/watch?v=2Fko7_SV3Lc&ob=av2e
  • offf aaaaaaaaaaaaaaaaaa))) eu am intelesss...anul asta cele 12 puncte ale moldovenilor merg catre elvetia)))
  • Tigra Elvetia e buna la ceasuri si activitatea bancara...nu la cinteceeee (( XD acolo e conducerea Lumii intregi)
  • 1 aka cn terebuie sa se duca la eurovision
  • pfffffffff cam slabuts Elvetia
  • !!! eu nu inteleg ce folos daca prezentatoarele sau schimbat in alte rochii?!
  • guest_211 daca cinta cineva de la noi acest cintec, ave sa zica toti ca e rahat, parca vad
  • V.O. rezultatele va roog mmair epede!
  • shul tu vezi ce tineret avem in tara care nu stiu de a vorbi frumos
  • guest_88 cind o sa fie rezultatele stie cineva?
  • toarna un stakan di JIN hai ka miine la lukru damu
  • cgchv open your eyes dara
  • toarna un stakan di JIN mai repejor
  • guest_149 opa:D
  • Don Pedro andreea ma alegi pe mine sau pe pula scurta-tipa 21cm
  • bu sa fi venit fata din SUEDIA....
  • klm saluuut elvetiaaaaaa
  • :P da ce spectatorii stau in picioare?...
  • -Man Darinas- Unbrokable.... blah-blah-blah...
  • Mihaela andreea xD comentariile tale ca raspuns ma fac sa cred asta
  • ghita Молдавские дедушки la Eurovision!
  • Yes oameni inca5 min mai avem de rabdat:))))))))
  • guest_58 guest_211daca cinta cineva de la noi acest cintec, ave sa zica toti ca e rahat, parca vad | e rahat
  • euro eu am pu silence la eurofignea si ascult disturbed
  • limon asta e cel mai groaznic..sa vezi cum degradeaza tinerii..
  • ghita Azi am avut parte de Piza musicala
  • kir in raport cu moldova..acestia au ceva as putea asculta cintecul de vreo 5 ori pe cind nici unul din MD makar de 2 ori
  • bruni salut,saluuut!!!
  • Tate oh, gosh!
  • Tate Accentu.
  • Topo ooo...disturbed...asta da muzicaaa
  • VADIMEL fenkiu veri maci gais)))))))))ce prostalai prezentatorii...haaaah
  • andreea si a ta de cat este ?
  • limon Shul si tuesti liceean sa inteleg?da?
  • offf ooff iar camera verde...
  • ghita se filfie
  • shul drasnic degradeaza
  • eu iaka Elvetia n-are lente si biciclete :D pacat...
  • guest_62 loreeen come in md
  • Don Pedro cn o obijdueshte pe andreea prineste pizdon desel zaebisi
  • WTF shi cishtigatorul este.........?
  • guest_210 cine e acest din camera verde?
  • Don Pedro ka la ded maksim
  • MAIUL inpauza o baut vin
  • -Man Darinas- Am baut in pauza!)
  • shul da sun in clasa 12 real
  • guest_195 piiirt
  • guest_211 go parfeni!
  • euro ce-ati facut in pauza asta ne-am futut
  • Don Pedro 21 s jumate
  • ghita ...dar Green room avem!!!
  • ich bitte sehr
  • limon exact
  • WTF daway
  • fsd piiirt
  • oana darrraaaa please
  • guest_132 hahahahaha
  • WTF pidarule
  • ((( aaaa
  • Iaka In pauza au fost nervi si ...
  • WTF pidarule
  • WTF pidarule
  • Bloodvik vot pidarasi :d
  • -Man Darinas- ei hai...
  • oana debili
  • aQua publicitate!!!!
  • B eiiiiiii
  • bu wtf
  • V.O. care publicitaaate?
  • guest_211 faaaaaail
  • Olga in plm de reclama
  • milly capetz.....
  • offfff care publicitate?????????
  • Cristina) publicitate,..super
  • ghita Green Room parca subsol
  • guest_149 pidari
  • -Man Darinas- ko_ro_na!!!!
  • limon si eu tot a 12-a numai ca profil umanist
  • Cristinuta publicitate
  • Mihaela Ablom karo4
  • sweety hahahah
  • 1 ANIMALA!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!1
  • Natasha` :d
  • JustAGuest skatini si sint...publicitate cui ii trebu acum?
  • shul dai bacul anul acesta
  • :)) futuvash in jabhdknxjfnaduh281374dnx de reklama
  • Cineva :d
  • Yes publicitate!!!!!!! WTF
  • VADIMEL gandon tolea ista
  • gaga ce idioti
  • Tate Ei, nu e interesant
  • Don Pedro cu jumate de cm mai mult da ii mai gros cu vo 2- asiusenbiile is mai pizdoase
  • guest_150 :D sughiță tare amu :D
  • offfff mama ei de publicitate
  • MAIUL cemodan
  • Michelle Dordom ramashka
  • Vanga hamiaku s o kishat pe laptop cand i o auzit :D
  • gaga tre' sa fii tare idiot sa spui ca anunti rezultatele si sa bagi publicitate
  • Tigra anatol e glumet) xd xd publicitateeeee
  • Iaka Publicitate
  • Tigra xdxd
  • shul nu cumva esti din cahul
  • Tinutzu:* eii caroce
  • andreea am impresia ca te supraapreciezi copilashule sau ai deliruri ;) e importanta totushi speranta
  • limon sigur ca il dau//?ne pregatim intens
  • bruni korona,mama ei de korona...
  • guest_66 S-au distrat in pauza ca dupa asta nu cred sa mai aiba chef:)))
  • Tinutzu:* ku reklama asta a lor
  • DJIGURDA blin maine la svoala
  • offfff aaa iak ce fac in camera verde))) se rad))))
  • DJIGURDA scoala*
  • Cineva Vanga iaca tu cadru
  • God cit se poate aita publicitate
  • euro nimic in viata asta n-are sens dupa eurofignea mi-am dat seama
  • Vero Wow the blonde on the left has an irritating voice!
  • WTF Numa la moldoveni poti vedea asa cv Publicitate inainte de asa un eveniment .....))0
  • pfffffffff vai ce reclame sexuale pe aici.....
  • guest_205 mdaaa voi spuneti ca nu merita sa ne reprezinte nici unu ..da uitativa dintai la voi ..cum vb si pe urma vreem sa intrem in UE cu asa societate precis o sa intram
  • limon tu ai odnoklassniki?
  • shul bravo
  • parfenii Парфений победит?
  • Chuck Norris Eu tot invat la liceu - la toate profilele odata!!!
  • guest_158 de ...visina....
  • ghita The_Bigsy Wow the blonde on the left has an irritating voice! #Eurovision #moldova
  • guest_62 scrieti din ce colt al moldovei sunteti
  • Chuck Norris Duru are grija de pielea dumneavoastra!!!
  • limon sunt de la sud-centru
  • Eurovision duru dura
  • 1 aia era visina sau rodie/)
  • shul da am
  • Mihaela andreea am impresia ca priveshti in oglinda shi scrii tot cetzi zice inima
  • Eurovision o,molped)
  • 1 Puterea fetelor e in Molped!!!
  • shul tu
  • Iaka Pavel Turcu is the best!!!
  • phillo chuck norris, da-mi nr tau, sint o mare fana a ta :D <3
  • silence lume....e timpul sa ne dam seama la discutiile purtate si la vorbele timpesti aruncare pe net....rusine....tara de ratati si needucati...
  • Irina duru spala bine curu
  • guest_211 duru, molped, korona, lideri pe piata rurala
  • Eurovision cistaia linia;D
  • offfff cistaia kladka)))
  • limon imi spui cum esti scris/
  • limon ???
  • angela unde-i andreea? reclama cu molped :)))
  • guest_73 aveti molped?
  • andreea Mihaela am impresia ca iti este somn
  • Don Pedro andreea nish nush cn din noi ii copilash) da dac vrei s faci cunostinta cu aneu ap da nr de mob
  • shul cimislia
  • Mihaela aprpopo ai o inima ft obiectiva
  • Ioana Eu azi am hotarit, imi cumpar sampun de la cistaia linia!
  • ich dar"vedetele" astea care vorbesc russeste, s-au nascut in MOldova????
  • guest_230 pizdira
  • BarakObama Moldova you suck, Usa is better than you
  • 1 prima data aud....aoca
  • Nick peste vrio 50 de ani poate va gistiga si Moldova la Eurovision
  • shul eu is baieat
  • Vanga duru pentru hamiaku meu :D
  • Mihaela itzi spune totul exact despre tine
  • andreea ;d:D:D:d;d;d
  • Tinutzu:* ii karoce
  • angela ich, da tu esti baiat sau fata? :)
  • V.O. come on reclama de jumati' di cias!
  • Nick DA in Moldova sa nascut.
  • limon si eu domnisoara
  • WTF JEedward iarashi la eurovision :D
  • offfff ko ro na ...koroooooonaaaaaaaa....koronaaaaa....cumparatz sh mancatz))
  • shul spunem tu eu te gasesc acuma
  • BarakObama eu cinteku d la korona pe derost il stiu
  • ghita Korona e din grasimi vegetale atentie ce consumati!!!
  • mira Parfenii...
  • limon altceva?
  • JANEL pun reclama la korona cu vocea cristinei croitoru ))))
  • Don Pedro bleee, andreea ii pre timida- pahod ii virgina< mihaela esti libera?
  • VADIMEL let's sing barbara straisand: uuuuuuuuuuuuu pavel turcu uuuuuuuuuuuuu pavel turcu....pavel turcu....uuuuuuuuuu
  • 1 offffffffffffffffffffff
  • Tu nea mancaaaa
  • guest_248 Care și ce păreri are? Eu cred că Croitoru, dar aș vrea Dara. Nicidecum Parfene, Acord sau Ursu și mulți ații ...
  • andreea am fratior de 19nani , vorbind cu tine il vad pe el :D ... atata vis si naivitate
  • shul imi pare bine
  • guest_61 :d:d
  • guest_62 ce tara sustineti la euro?
  • 1 ko ro na ... bo ro na
  • :P este cineva care merge la olimpiada clasele 9-10? ...:D
  • BarakObama mai pune ar pune reclama cu donare a singeluo(
  • linda cristina croitoru, vocea la Korona
  • miki chiar daca si am cistiga interesant unde de organizat tot evenimentul...hai sa fim seriosi lume :)))
  • ich ooooh, Angel ;) madchen
  • WTF JEedward iarashi la eurovision :D
  • WTF JEedward iarashi la eurovision :D
  • Chuck Norris bla
  • WTF JEedward iarashi la eurovision :D
  • Iaka Vind locul 1 la Eurovision 2012, oferta limitata!
  • Chuck Norris bla
  • Lucho mai bine Dara
  • asd123 Mihaela,andree,deci voi doi oameni care nu va cunoasteti va certati nu stiu de la ce,apare intrebarea,la ce naiba aveti sa demonstrati una alteia ceva?
  • Vanga sfarsitul e aproape
  • limon hai tu fa primul pas!!ca esti gentilmen?nu?
  • Chuck Norris bla
  • Mihaela andreea imi pare rau pentru acela cu care vorbeshti
  • guest_62 ce tara sustineti la euro?
  • guest_62 ce tara sustineti la euro?
  • guest_62 ce tara sustineti la euro?
  • Mary lipsesc cei 7 ani de acasa a celor care nu stiu a vorbi gramatical si frumos, aia de pe scena mai mult de atat au ajuns sa acante pe scena, dar nu stau in fata calculatorului sa arunce cu murdarie in gradina altora. rusine de cei needucati.
  • guest_62 ce tara sustineti la euro?
  • :)) de la tampoane la shampuni, de la ciocolata la sapoane, de la telefoane le televizoare - iaca tot Eurovisionul moldovenesc ....bagamiash...
  • ghita Ce multa lume buna!
  • euro nimi n-are emotii
  • shul victor tutuianu
  • angela ohhh, Scheisse
  • ionel romania
  • guest_211 vine acuș marea dezamăgire
  • Don Pedro andreea tu ai darvo 30 ani?????
  • oana doamne ce o sa ne facem de rusine
  • ChuckNorris Hai fa odata!!!
  • Don Pedro esti batrina pizdes
  • limon aha..merci
  • Misu Barak , ce legatura are USA cu Eurovision ?
  • shul tu cum te numesti
  • God ia mai intinde timpul
  • sqrt(cos(x))*cos(200 x) sii tat
  • WTF Hai suka
  • limon din Cahul esti???
  • ghita fuuuuuuuuuuuuuuuuu
  • Tu iiiiiiiiiiiiiiii
  • BarakObama pizdetz
  • silence terminati mai odata prostiile estea
  • -Man Darinas- nici nu-i de mirare)
  • WTF Psd ii shi ish bat jiok
  • limon te-am gasit
  • Tate Si pizdets
  • guest_211 fuuu blea
  • offfff oooooooooooooooooooooooooooo croitoru )))
  • Chuck Norris coooooruptie!!!
  • WTF pasha parfeny lok 1 trebuia
  • B mdee
  • Chuck Norris coooooruptie!!!!
  • Tu beaca
  • oana numai nu croitoruuu
  • shul da
  • hhgj croitoru bravo
  • VADIMEL pidaraz pidaraaaaz
  • Bloodvik Cristina asta cine ?:
  • eeeeeeeeeeeeeeeeeeeeeeee era si de asteptat l asa rezultate
  • God Cristina Croituru wtf?
  • anna o boja, asta e feeric
  • Kris mdaaaaaaaaaaaaa
  • guest_71 juriu ce ibale au aestea vai de dinsele
  • Chuck Norris duti fa!!!
  • Don Pedro andreea eu am numa 23 de ani
  • ghita Cinta foarte urit!!!!!!!!
  • Ioana eee, o vazut'o cineva la Vocea Romaniei???
  • parfenii sau Croitoru
  • sqrt(cos(x))*cos(200 x)) huinea
  • euuu deloc surprinsa de vot, stia precis ca Korona vor baga bani
  • offfff cuuum cuuum cuuum))))
  • WTF fuuuu croitoru huinea
  • ich Angel....warum??? suchst ein yungs? ;))
  • guest_34 x(
  • Mary bai degheneratilor , ce ati votat? prostilor.
  • mikutza adrian ursu....kikat..
  • Don Pedro ma scz da eu dam nu mai vreu cu tn s ma intilnesc)))) mii de scuze
  • cris taker deacord corupte
  • American Boy Mlea...macar altcineva
  • f_89 dap asta se chinuie de vreo 7 ani ...trebuia sa se duca odata
  • Iaka Bravo Cristina! Mutumesc pentru cumparatura!
  • fffff de ce dara asa de putin?(((
  • asd123 apff...croitoru =.
  • guest_211 croitorul beak!
  • Z1Z1 Hai toti pt Pașa!!!
  • MAIUL karoce o suka mare blea Croitoru
  • B de ce eeee
  • bu fuuuuuuuuuuuuuuuuuu
  • euro pasa v prolete
  • :)) aista o inceput sa dea din maini ca omu' de la "Vrei sa fii biliarder" XD
  • offfff pasha will be back in kiev)))
  • guest_211 pasha!pasha!pasha!pasha!
  • Vanga eu stiam cine va castiga :D
  • ghita Pasha a cheltuit multi bani!!!
  • Z1Z1 Toți pt Pașa!!!
  • sqrt(cos(x))*cos(200 x)) ma beshesk amu tare jistoka
  • guest_61 mai mai ce cultura aveti, daca injurati atat, rusine sa va fie
  • ghita msi guta e fine
  • Chuck Norris cei cu galbenushul ista??????????????///
  • cris taker pasa e o lina
  • euro de ce-ati votat pentru croitoru dibili
  • Don Pedro andreea da las c asti gasesti altu
  • Bloodvik pasha !!!
  • ChuckNorris v proliote loshari
  • Bloodvik pasha !!!
  • cris taker el se anina de toate padrujile prin oras
  • gaga daca omnul talentat nu e apreciat la el acasa merge in Kiev
  • ana* da..pasha parfeni..merita cel mai mult sa kistige
  • guest_205 pasaaaa haiii merita !!!!!
  • bruni Hai,Pashca,hai
  • Bloodvik PAsha !!!!
  • Voronin si va uitati voi aishi? sus lenin
  • cris taker mai ales prin cluburile de noapte
  • Vero acum juriul face SHURA mura
  • sweety am zis ca pt croitoru a votat Corona
  • Don Pedro viatza continua da eu dac seva poate as te prinesc pe o noapte)
  • MAIUL primele doua locuri sunt lana mare
  • f_89 nu mas mira se se fi dat bani .....
  • cris taker pasa e o lina
  • iuh BAI idiotilor care guta??????stergetii,fugaritii nah de aici
  • :) <3 <3 <3
  • Bloodvik pasha pasha
  • cris taker el nu merita
  • guest_211 please! numai nu croitorul!!!!
  • guest_161 am senzatii ca totul era decis inainte de a incepe concursul
  • Trance cris taker, tu esti o lina!!! stinge lumina si dati o palma pe intunerik sa nu vada nimeni
  • guest_100 sa vina voronin!!!
  • ghita Ar fi bine juriul sa anuleze circul de azi si mai faca o noua preselectie!
  • kyoko cine e favoritul??????????
  • ChuckNorris hai hai hai hai hai hai hai hai hai
  • ChuckNorris misca
  • ChuckNorris da din fund
  • guest_211 croitorul fail!
  • guest_100 vornonin cu plicul !
  • ChuckNorris da din fund
  • WTF Hai nagacevskii cu pasha inainte
  • offfff doamna notar...cu gust de korona))
  • mira doamna natar ...haha
  • ChuckNorris da din fund
  • guest_143 tacere multa..
  • gaga astia mai au notar :D
  • Natasha` acush iar o sa spuna ca ii publicitate
  • voronin am vinit!
  • Don Pedro ble in chatu ista numa devstvinishi shtoli?????????
  • Puff ce treabă are notarul cu eurovizion?????
  • Voronin hai liniste ca am dat ordin sa castige Parfushka
  • guest_62 cristina
  • nico are gusturi rafinate o sa aleaga parfeni
  • VADIMEL vocea sponsorului general CORONA era a Cristinei Croitor...si aparea in pauze....ne 4esno.................
  • wa eu nustiu mai bine parfenny totusi
  • cris taker chuk noris da poate filmam un film impreuna?
  • guest_41 :d
  • guest_79 să pară şi ei mai corecţi
  • cris taker ce spui?:-)
  • gaga sa se streaga doamna notar de ciocolata :))))))
  • DJIGURDA ce frine
  • Banditosik evelina-shliushka :)))))))
  • guest_122 dupa alegerea de azi imi inchipui si dezamagirea de miine cu desemnarea candidatului la presedintie
  • guest_79 modloveni :))))))
  • American Boy fuuuuu caca
  • guest_117 cum ce are?
  • guest_211 pasha !
  • guest_104 aista e teatru mai oameni...banii hotarasc totul....da chiar nis nu avem din ce alege
  • necunoscut trebuie dan balan sa fie
  • ChuckNorris haqi mai repede din fund
  • ghita 12 Points - Pavel Turcu
  • guest_107 Nimik, dar este Nagacevski ))
  • pif valideaza voturile
  • guest_100 ba ce organizare :)) ... nagacevschii vine cu parashuta :))
  • ce clounada
  • Trance Don Pedro, nu da numa pe tine viatsa tio avut pina amu :D
  • :)) doamna notar e ocupata cu adeverinte de nastere romanesti ... datii pace...
  • gaga Doamna notar tre sa numere onorariul :))asteptati prostilor
  • sqrt(cos(x))*cos(200 x)) haii la bishi
  • gaga asteptam...
  • wfl do pedro...dute si fa o minutsa si gura mica
  • offfff ea vine din bacu))))))
  • -Man Darinas- sa speram ca-i din inima)
  • dna notar ambuteiaje!!! mii de scuze!
  • GADAFI oameni buni eu citi bani am virit in eurovizion nis nu aveti ideie:d
  • uuuuuuuuu Si de concinaia Cristina Croitoru asta,blea o sa praibeasca totul si as fie ultima in Bacu!!!!!!!!!!!!!
  • offfff doamna notar ne va spune prin skype))))))))
  • GUEST_101 bah faceti in pula mea ceva cu lagurile astea bagamiash pula in serverul pulii voastre!
  • MAIUL unde-i turcu ??????
  • Mihaela andreea eshti asha de jalkaia chiar shi Don Pedro s-a dezis de tine!
  • guest_211 croitoru sta cu pusca la capău lu nagacevski
  • guest_100 croituru clar ca
  • ChuckNorris aceeasi rochie avea si anul trecut...
  • sqrt(cos(x))*cos(200 x)) teotea vera o padhadit
  • iuh ducetiva-n cu
  • ghita avionul lui plahotniuc e la dispozitie!
  • :)) hai Pashunea... faram nuca intre buci
  • B o sa plece Croitoru
  • Vanga hai la hiroshima ...
  • iuh absolut kikat
  • Iaka (iar) vind primul loc la Eurovision 2012, oferta limitata!
  • DJIGURDA nu s vede
  • Don Pedro fetele eu vb serios! dau de futut da la relatii serioase nuy contati
  • guest_250 clar se vede
  • ChuckNorris tat vad....
  • WTF Pasha la eurovision
  • VADIMEL toti vedeti ecranu???haaah
  • GADAFI www.fondultinerlor.md
  • GADAFI www.fondultinerlor.md
  • Lika hai afara
  • Z1Z1 Pașa 12
  • GADAFI www.fondultinerlor.md
  • muhha pasha
  • WTF uraaa
  • GADAFI www.fondultinerlor.md
  • GADAFI www.fondultinerlor.md
  • guest_107 iaca si spam ))
  • :)) oi blea.... ochii mei...nu vad nimic
  • GADAFI www.fondultinerlor.md
  • GADAFI www.fondultinerlor.md
  • WTF pasha
  • euuu pasha pleaca
  • pfffffffff croitoru arata cam relaxata
  • Don Pedro wfl tu fa o laba s bagati mina in cur
  • VADIMEL molodets
  • WTF uraaaa
  • guest_132 оооооооооооооооооо
  • Natasha` uu
  • baku danu nafig?
  • Don Pedro bago scoateo bago
  • guest_88 uraaaaaaaaaaaaaaaaaaaaaa
  • B uraaaaaaaaaaaaa
  • Kris uraaaaaaaaaaaaaaaaaaaaa
  • pfffffffff bravo pasha
  • Bloodvik pasha se duce ! waii
  • y ihuu pashaa
  • Natasha` pasha uraaaa
  • kuku ăiiiiiiiiiiiifuuuuuuuutttttttttttttttttttt
  • Kris uraaaaaaaaaaaaaaa
  • offfff opanaaaaaaaaaaaaaa)))))))))))
  • f_89 iuuuhuuuuuuu
  • lol uraaaaaaaaaaaaaaaa
  • fuuu ujaaaaaaaaaas.....pozooooooor
  • miki uraaaa
  • SHOK omg
  • parfenii ndaaa
  • ngelish pizdetz.nuuuuuuuuuuuu parfenii
  • -Man Darinas- o_o
  • sweety uraaaaa
  • B uraaaaaaaaaaaaaaaaaaaaaa
  • goga gosha jora aaaaaaaaaaaaaaaaaaaaaa
  • American Boy mda...mlea
  • guest_132 кроитору пусть сосёт)))
  • Kris bravooooo
  • !!! bravoo.....klasss
  • goga gosha jora ce huinea
  • Lucho Pasha o Cishtigat?
  • ce fffffffffffuuuuuuuuuuu
  • Olga ia ibu
  • Lika eeeeeeeeeeeeeee iaka asha maladetz dai kiss lu putulica
  • oana mai bn k croitoru
  • -Man Darinas- 1 punct pentru Manciu?
  • Chuck Norris asa mai merge
  • Trance pashka malatok
  • bu ffffffuuuuuuuuuuuuuuuuuuuuuuuuuu
  • necunoscut daca cistiga moldova urmatorul eurovision ar fi pe aieroport
  • 333 ia iubu tu
  • guest_161 cacat
  • guest_11 mda
  • guest_211 bravooooo! pashka=cerepashka
  • mira vahahaaaaa
  • euuu ujaaaaaaaaaaaaas
  • guest_24 Bravo, Pasha!~ Meritsi totsi laurii!
  • American Boy fuu pasha hassa gavno
  • guest_6 piutannnnn
  • guest_62 o meritat
  • bu fuck you Pasa ca esti levii
  • guest_117 BRAVO, de cind se chinuie saracu sa se duca
  • goga gosha jora hai vina odata
  • muhha Dara tot merita
  • lilly bravo
  • me pasha da... padrug'sa ii levaia :)))
  • :)) Geta ...7 puncte...wtf juriu....ati facut asta din mila?
  • guest_205 bv pasaaa !!!
  • guest_150 guest_161cacat
  • VADIMEL better than croitor
  • dima pasha - bik
  • MAIUL pizdiusi
  • Don Pedro olga ia ibu????
  • lynka piutan de merde
  • ChuckNorris gata nu se mai duce la kiev :D
  • Topo Pashkaaaaa
  • ea Bravoooooooooooo!!!!!!!!!!!!!!yess!
  • ChuckNorris ramai aici cu romanii ;)
  • ChuckNorris fa
  • -Man Darinas- Cred ca Parfeny leashana)
  • Don Pedro dac vrei poti s de la mine so ibesti
  • guest_150 guest_161cacat, tu ești așa!
  • MAIUL pizdiusii o votat parfenii
  • guest_100 speram sa ajunga in top 10 acolo !
  • Trance dima - ciumadan :D
  • fffff eu tot vreu tablet(
  • katy da sunt prosti de rag
  • RED So speriat juriu ka merge la kiev
  • lynka pasha nu tre ca nu va entuziasma publikul
  • mere da ladna?
  • guest_104 nu intram in finala uuuuraaaaaa
  • guest_150 dimapasha - bik, tu ești bîk!
  • lika pasha maladetz vreu sh eu tabletka cu dejitu ;(O
  • guest_161 cacatcacatcacatcacatcacat
  • goga gosha jora tablet huinea lu ashela io dat ipad
  • guest_58 ii kitaiskii, nu=ti trebuie
  • lyncaa se scrie putin a si numele
  • SHOK p/u ce sa mai votezi daca pin la urma decide "juriul" ??? :|
  • lynka macar cristina facea ceva
  • melly :(
  • wfl passha best
  • Kris bravooooo Pashaaaaaaaaaa
  • guest_150 maiulpizdiusii o votat parfenii, tu ești pizdiuk!
  • VADIMEL haaaaaahprezentatorii is prostalani taaaaare
  • :)) spectacol de rahat.... sa ma f####
  • lyncaa se scrie putin
  • dima trans - fa-o la vale...te rog frumos chiar...alaturi de Pashka
  • THG oooooooo pasha !!!!!!!!!!!
  • cretzulea uuuuuurrrrrrrrraaaaaaa...macar bine ca nu Croitoru ....
  • Kris sarmanu asa retraia
  • Ingeras Eu am tablet
  • iuh pashutaaaaaaaaaaa
  • Kotovskii Mai Bine Pastet decyt Croitoru
  • Vero If there is one positive to take from tonight, we now know watching Moldova's national finals are a bad idea.
  • melly croitoru mai ciotkaya
  • guest_211 go pasha! bunisoara piesa
  • ghita rusine!!!
  • guest_203 :))..nu din mila ci multumita kumatrilor are jeta 7 punkta
  • guest_205 dap tableta ii shi Ipad
  • Dima Orhei lika nu numa tu xD
  • guest_205 :d
  • lika uuu aaa oooooo
  • Pizdet Juriu cumparat
  • rod prezentatori kikat....au niste voci..capets
  • American Boy totul din cauza juriului,el a decis
  • lika hai baietz la culcare
  • Kris si anul trecut merita
  • sweety bravo pasha
  • Kris talentattttt
  • Vero which normal persone could waiting for this 4 hours ?
  • goga gosha jora sh din nou rasuna muzika
  • LUPU #Vero, shut your trap and learn the damned language
  • Trance opaaaaaaaaaa
  • pechiu iiiiiiiiiiii koncinii di tat pasha, bag pula in kapul juriului
  • Trance hadi wai
  • VADIMEL hop hop
  • kuku nu,,gata,,eu stîng
  • goga gosha jora akolo in scene o strigat gorika :ddd
  • Ingeras Da ap eu am ipad 2
  • Dada Ole ole ole ole!!!!
  • mikutza Dara ai fost super....
  • DJIGURDA ce-i cu dvijeniile estea
  • lika eu fac plashinte si ma uit la pashka herneashka nii plashi
  • mikutza parfeny la gunoi...
  • cgchv bravo pasha
  • guest_211 e buuuun! decit cristinoaia....
  • lika iii shi prikid are el prikolini
  • esmy bravo,Pasha!
  • Jora dalbaiobi de juriu
  • cgchv dar dara a fost cea mai buna
  • guest_142 maladetz pasca!!!
  • Trance pasha rupili bushili
  • lika sa bai glavna ca cinta si nu so dus ursu
  • goga gosha jora ingerash da de unde ai bani de ipad 2?
  • valencia Dara am vrut tare
  • Jora si sa faca cu piesa asta la eurovsion?
  • Pizdet special a pus Croituru 4 puncte...deodata sa vede ca sunt cumparati...chiar daca mai tare Parfeni le placea in nici un caz nu punea 4 puncte la Croitoru
  • VADIMEL paska herneaska??lol
  • guest_117 Bravo...original
  • cuc bravo pasha, ma bucur pentru succesul lui
  • Trance pasha inca anu trecut trebuia sa se duca :P
  • guest_174 am vrut dara dar merge si pasha...
  • lynka dara a fost originala
  • guest_62 sau dus sperantaele cristinei
  • Chuck Norris lika hai ca eu vin cu un pahar de vin la placinete
  • lena cgchv de acord
  • valencia daraaaaaaa
  • :P nimeni nu a votat-o pe dara...? de ce asa sa primit? ..:(:(:(:(
  • guest_122 ni riba ni measo
  • guest_205 mai bine dam pasa ca croitoruu adormem dupa cintecu cela
  • guest_205 aista macar ii mai vesel
  • lika tu esti cumparat cu 2 lei
  • Trance vadimel dalbaiob mai esti wai!!!
  • Kris daaa si dara e talentata cintecul e frumos....dar mai puternik pasha pentru eurovicion
  • ghita se screamana!
  • guest_117 mda, aici a fost planuit
  • malinka numi place coreografia,e aiurea
  • guest_169 rip moldova blea
  • lika ca dara iiprastitutka eu licina am vazuto la albishoara
  • DJIGURDA imi aminteshte de Ribak, hz dc
  • miki bravo, are voce buna
  • guest_117 Dar oricum imi placeau amindoi si pasha si cristina
  • Vanga Vanga va spune ca nu va castiga Moldova la Eurovision ..
  • Bloodvik de ce nu au votatu pe dara findca nu o vrut sa cheluie parale pentru huinea
  • B ii mai bun ca croitoru
  • valencia eu am votat Dara,da unde ca lumea asta a noastra slaba....
  • =) WTF..... parfeni calaresti fetele =)))
  • iuh lalalala pasha
  • Vanga si va ureaza la toti noapte buna !
  • lol cristina tre sa plinga in hohote..era asa de sigura :D:D
  • bruni maladetz,Pashunica
  • parfenii у анс в стране причвыка все обосрать
  • Nick Pasha patan patan
  • olguta27 mai trebu in sala unul cu vioara
  • guest_210 Dara e noua un showbizz. va reusi sa reprezinte tara noastra
  • iuh dara are cea mai curata voce
  • ghita yellowbubblegum #eurovision pasha parfeny is way better than the others..but we are still ashamed..sorry europe
  • THG shi o calareste pasha pi aseia:d
  • lika critina treb sa suga in hohote
  • lika cu pine way
  • ich bineeeeeeeeeee, ca oricum nu aveam ce alege.
  • cgchv dara eurovision 2013
  • zaibit damu gata mam zaibit
  • dima http://www.youtube.com/watch?v=UbDrFrGr2Q0
  • mihaela paralela 47 era cea mai normala
  • WTF Parfeni calareshti fetele =D
  • lika minkatz cu pine
  • VADIMEL noapte boona
  • guest_117 Pasha maladet, e simplu...merge cu rutiera de la Ciocana, nu ca altii mindri doar cu masina
  • hi melodie sortita esecului din cauza ca ai nostri nu pot fi originali
  • oana aia cu yellowbubblegum eu am postat :)
  • lika shi paralela?? shi jiasaz
  • lika jisule
  • Trance wseo la kulkare tatsi
  • ... salut la toti:D
  • SHOK cum credeti ce loc ia pasha ? )))
  • uraaaaa uraaaaaaaaaaaaaa pashaaaaaaaaaaaaaaa
  • mira piesa de anul trecut a lui pasha a fost mai buna
  • vind un par din cur cu jumatate de pret ap si saude akolo>
  • ich paralaela 47...e doar pentru stiri nu pentru scena. fiti seriosi....nu face Alecu muzica ))))
  • pfffffffff gata baieti la culcare miine e zi grea
  • Trance hi, tu esti original?
  • guest_210 Chiar e bravo, Pasha, cinta din tot sufletul
  • olguta27 nb
  • guest_211 du=te tu si arata cum sa fii original
  • ... 10-15
  • guest_104 nis in finala nu intram
  • bruni Gutte Nacht.Ciuß
  • lika bai el damu o luato
  • guest_248 da cu care rutieră? :dd
  • arthemis tre' sa faca modoficari la show- sa nu fie interpretate cumva nuantele cu a calari fetele si a imita ca se bate cu ele sau chiar pune piciorul pe le cand sunt jos...
  • bu ma duc sa ma uit la dom2....foarte dezamagita
  • nietzsche pasha ia 13 in cel mai bun caz,daq ajunge in finala ((
  • monaliza nb
  • ghita Rhys_Fantastico never again watching a final from Moldova- and after all that crap THIS won? #eurovision #moldova 52 seconds ago · reply · retweet · favorite
  • lika tu nu intri
  • lika la el e micutza sh as intre
  • guest_159 haha
  • lika da shi esti extrasens
  • mihaela d:
  • lol16 haha
  • mihaela :d
  • lika monaliza culcate
  • lol16 cantecu e cam slab p/u europa
  • mikutza ai gresit..
  • lika tu esti slab
  • corina cintecul chiar ii bun
  • ionel unul care schimba md pe ucraina , nu merita sa castige...fuuuuk pasha și la toti dobitocii din juriu si moldova care au votat...pidaraji
  • ich Tschuß!!!!!!!!!!!!!!!!!!
  • lika maninka cu pine sh as fie bun
  • lika ionel maninka ku pine
  • lol16 "pidaraji" cica
  • lol16 =))))))))))))))))
  • lll sa fost Sunstroke Project cu olia tira nu erau probleme
  • guest_161 pashka kakashka
  • Lucho inca un an pierdut
  • Trance Expertilor mergeti la kulcare va rog
  • mihaela nebuni nau ce face se duk dam la baku
  • Ioana S'o scapat baiatu, nu stia ca va cistiga si o zis'o si el... a fost la emotii )))
  • vika la culcare
  • mikutza Dara orikum ia btut pe toti..juriul nustiu unde se uita.
  • Trance o pula o facut si tira
  • guest_124 croitoru a patit a si carisma anul trecut :) saraca...
  • mihaela tzii somn dute:P
  • vind un par din cur cu jumatate de pret vre shineva>??
  • guest_126 mi jale chiar de croitoru
  • Trance bagatil in nas si scoatete din pana
  • guest_239 asha ,zaibisi
  • guest_192 cine a cistigat eurovision 2012 spuneti va rog mult
  • guest_192 ?
  • guest_57 Pacha man
  • guest_123 Pasha Parfeni
  • guest_57 Pacha man
  • guest_42 shini o cishtigat k nam fost acasa?
  • vadim cn o cishtigat k nam fost acasa?
  • guest_11 citeste wai mao jios
  • guest_23 cine va reprezenta moldova la eurovision?
  • sizu Parfeni a cistigat, bravo lui !!!
  • ciocarlia oameni nebuni
  • corina cei cu bredu ista ???
  • kukurigu cine a cistigat??????/
  • kukurigu ???
  • guest_81 parfeni
  • corina o sa fie dezbaterea privind finala eurovision???
  • guest_126 da shii asta?
  • guest_126 mai. nnu sii ku bredu ista
  • guest_185 o sa se explice care si de ce a ales un anume concurent
  • guest_126 mie pasha nu-mi place, da posibil ca juriu l-a ales fiindca prea multe fete deam o castigat in restu tarilor de imprejur?
  • Mihai Staver Vreau sa spun ca Pavel de multi ani se chinue sa razbata la Eurovision, dar membrii comisiei nu il accepta, a devenit vedeta in RM datorita concursurilor enorme cistigate in UK, tot asa nu putea cistiga Steau Elatului din cauza Juriului nostru bun, si datorita Larisei Doline din Russia a cistigat I loc, si eu sunt cintaret dar pe Pavel il inteleg foarte bine!
  • Mihai Staver Eu tot era sa schimb MD pe UK sau RO decit sa-mi puna note Geta Burlacu, ma refer la 2011
  • guest salut
  • porecla sii gata?
  • guest_248 bravo pasha felicitari!
  • Nata Bravo Pasha!!! Mi-a placut si prezentarea Nicoletei Dara!!!
  • Moldoveanca Nu sunt de acord cu juriu, nu poate dansatoarele din alta tara sa ne reprezinte! Ce noi nu avem cu ce ne mindri? Si piesa care a ocupat locul I - nu are nici un sens,dar dansul fetelor-ce stil?ce ne reprezinta? Rusine la Tara Noastra- cu asa ceva sa iasa pe scena!
  • Stefan Normal,toti au depus efort!Live e greu sa kinti!NU cred ca merita numarul lui Pasa Parfenii sa ne reprezinte! Un dans haotc, cu niste micari a miinilor neclare. Dansatorii Dnei C.Croitoru si Gherman- s-au prezentat cu mult mai profesionist si la tema!
  • Sanda MOldoveni!, Ce se intimpla? De ce dansatori din Ucraina? ce noi nu avem dansatori? ....si ce miscari?--de parca is la circ p/u copii!...-opriti-va! nu ne faceti Tara de Rusine!
  • Sorin da..cu asa numar ne facem de rusine! Nu vom intra nici in primii 10! Kiar e asa komplicat? sa gasesti o voce in Moldova? si dansatori? aitea vedete avem! - Atitea dansatori profesionisti! Ce face Ministerul Culturii? Si TV Moldova? Sau cu politica asta sau incurcat?- Ucraina? sa ne reprezinte?
  • Banari Pe cine ati votat? Juriu? unde va uitati? Cei cu danatoarle/sperietoare? Am avut toate sansele....in o tara vecina cu noi, si care ne cunoaste mai aproape!- sa ne voteze, iar acum dupa asa numar - la urma sa nu nimerim ultimii
  • Intrebare cum pot gasi melodia celor de la alex calancea band? macar denumirea
  • guest_137 da cine a cistigat
  • ricardo da cine acistigat??

Prietenii tăi sunt aici!

Conectează-te prin Facebook pentru a avea acces la întregul site.

Aplicația Privesc.Eu pentru iPhone/iPad
Fii la curent cu toate evenimentele politice, sociale, științifice, culturale și sportive.
Disponibil pe Google Play Aplicația Privesc.Eu pentru iPhone/iPad

Durata înregistrării minute

Prin achizitionarea acestui material video vă exprimați acordul Dvs. față de Politica de confidenţialitate şi Condiţiile generale ale Privesc.Eu